FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623345_at:

>probe:Drosophila_2:1623345_at:36:381; Interrogation_Position=217; Antisense; GAACCAGATCGCATTACGGCTCTAT
>probe:Drosophila_2:1623345_at:139:241; Interrogation_Position=256; Antisense; AATACGGTGGATCTGCTTTTCTATC
>probe:Drosophila_2:1623345_at:187:487; Interrogation_Position=283; Antisense; GTAGACACCATTTGCTGGCTGGCCA
>probe:Drosophila_2:1623345_at:494:571; Interrogation_Position=299; Antisense; GGCTGGCCAGTCACAAAGTTTTCGA
>probe:Drosophila_2:1623345_at:372:211; Interrogation_Position=337; Antisense; AAGACCTGGCGCTTTGTGAACTCGT
>probe:Drosophila_2:1623345_at:310:511; Interrogation_Position=352; Antisense; GTGAACTCGTTACTCAGCATGGTCT
>probe:Drosophila_2:1623345_at:648:497; Interrogation_Position=373; Antisense; GTCTCTGCATACCTAAACGTCGTGA
>probe:Drosophila_2:1623345_at:541:191; Interrogation_Position=41; Antisense; AACTTCTTGATTCCTGTAGAGCCCG
>probe:Drosophila_2:1623345_at:628:217; Interrogation_Position=435; Antisense; AAGTCACTTCGATGTTGTGTCCCTT
>probe:Drosophila_2:1623345_at:609:503; Interrogation_Position=453; Antisense; GTCCCTTGCACACTTTTTATTCGAT
>probe:Drosophila_2:1623345_at:469:685; Interrogation_Position=470; Antisense; TATTCGATCTGCTTCACAACATCTG
>probe:Drosophila_2:1623345_at:423:53; Interrogation_Position=523; Antisense; ATGAAGCATTCATCCCTTTACTTGG
>probe:Drosophila_2:1623345_at:673:131; Interrogation_Position=559; Antisense; ACCGTTTCTGCTGGACTGGGAATTT
>probe:Drosophila_2:1623345_at:166:435; Interrogation_Position=79; Antisense; GAGGTATTATGCCAAAGTGCCCAAT

Paste this into a BLAST search page for me
GAACCAGATCGCATTACGGCTCTATAATACGGTGGATCTGCTTTTCTATCGTAGACACCATTTGCTGGCTGGCCAGGCTGGCCAGTCACAAAGTTTTCGAAAGACCTGGCGCTTTGTGAACTCGTGTGAACTCGTTACTCAGCATGGTCTGTCTCTGCATACCTAAACGTCGTGAAACTTCTTGATTCCTGTAGAGCCCGAAGTCACTTCGATGTTGTGTCCCTTGTCCCTTGCACACTTTTTATTCGATTATTCGATCTGCTTCACAACATCTGATGAAGCATTCATCCCTTTACTTGGACCGTTTCTGCTGGACTGGGAATTTGAGGTATTATGCCAAAGTGCCCAAT

Full Affymetrix probeset data:

Annotations for 1623345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720