FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623346_at:

>probe:Drosophila_2:1623346_at:669:577; Interrogation_Position=5095; Antisense; GGCCGTCTGAACTATCCTGTAAGAA
>probe:Drosophila_2:1623346_at:537:243; Interrogation_Position=5119; Antisense; AATTTACCACCGATGAACTCTCAAG
>probe:Drosophila_2:1623346_at:452:403; Interrogation_Position=5145; Antisense; GACTTATCCACCAAATTATCCACAG
>probe:Drosophila_2:1623346_at:6:301; Interrogation_Position=5191; Antisense; CCCTCTCGTCAATTTTTGCTTTCAA
>probe:Drosophila_2:1623346_at:361:341; Interrogation_Position=5208; Antisense; GCTTTCAATGCAACGTCTAGCTGAT
>probe:Drosophila_2:1623346_at:36:471; Interrogation_Position=5255; Antisense; GTTCGATCGAAAGCGTTGGTGGTTT
>probe:Drosophila_2:1623346_at:123:541; Interrogation_Position=5275; Antisense; GGTTTTATTCAAATGGCCTATGCAG
>probe:Drosophila_2:1623346_at:562:235; Interrogation_Position=5306; Antisense; AATACCGGACTCTTAAGGATCTCAG
>probe:Drosophila_2:1623346_at:77:585; Interrogation_Position=5381; Antisense; TGTGCAAAATTAAGCGTCCCAAGTG
>probe:Drosophila_2:1623346_at:341:503; Interrogation_Position=5396; Antisense; GTCCCAAGTGGCGTATCAGCAAGTT
>probe:Drosophila_2:1623346_at:527:465; Interrogation_Position=5484; Antisense; GTTGGAACTAAACGCTGCCTATCGC
>probe:Drosophila_2:1623346_at:714:179; Interrogation_Position=5532; Antisense; AAACAAGTTTCTACGCATGGAGTCT
>probe:Drosophila_2:1623346_at:447:309; Interrogation_Position=5627; Antisense; CCACGAAATGGCGTCTGCTCAATTA
>probe:Drosophila_2:1623346_at:563:677; Interrogation_Position=5652; Antisense; TAGGAAGCCACTTATTCACTTGCAC

Paste this into a BLAST search page for me
GGCCGTCTGAACTATCCTGTAAGAAAATTTACCACCGATGAACTCTCAAGGACTTATCCACCAAATTATCCACAGCCCTCTCGTCAATTTTTGCTTTCAAGCTTTCAATGCAACGTCTAGCTGATGTTCGATCGAAAGCGTTGGTGGTTTGGTTTTATTCAAATGGCCTATGCAGAATACCGGACTCTTAAGGATCTCAGTGTGCAAAATTAAGCGTCCCAAGTGGTCCCAAGTGGCGTATCAGCAAGTTGTTGGAACTAAACGCTGCCTATCGCAAACAAGTTTCTACGCATGGAGTCTCCACGAAATGGCGTCTGCTCAATTATAGGAAGCCACTTATTCACTTGCAC

Full Affymetrix probeset data:

Annotations for 1623346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720