FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623347_at:

>probe:Drosophila_2:1623347_at:653:81; Interrogation_Position=1037; Antisense; AGTGCGTTTTTGTGGAGAACTCCGC
>probe:Drosophila_2:1623347_at:644:145; Interrogation_Position=1074; Antisense; ACTAAGAGGCTTTGTGGCCTTCCTT
>probe:Drosophila_2:1623347_at:396:307; Interrogation_Position=1091; Antisense; CCTTCCTTTGTATCCAGTTCACAAT
>probe:Drosophila_2:1623347_at:117:521; Interrogation_Position=602; Antisense; GTGGAGCCTCGATTTGCCTGACAAA
>probe:Drosophila_2:1623347_at:397:507; Interrogation_Position=636; Antisense; GTGCGGCTGCTCCAAAAACTTTGTG
>probe:Drosophila_2:1623347_at:400:251; Interrogation_Position=678; Antisense; CAAGTGCATCAAGGGCTCCGCTTAC
>probe:Drosophila_2:1623347_at:326:343; Interrogation_Position=697; Antisense; GCTTACGGTGACACGTGCGAGCACA
>probe:Drosophila_2:1623347_at:436:717; Interrogation_Position=723; Antisense; TTCGCCGTGCAAGCTAAACCTGGGT
>probe:Drosophila_2:1623347_at:359:137; Interrogation_Position=836; Antisense; ACGACGATCTCGATGCGGTGAACAA
>probe:Drosophila_2:1623347_at:704:237; Interrogation_Position=859; Antisense; AATCTGGAGCGGATCACTTGCGCAC
>probe:Drosophila_2:1623347_at:101:527; Interrogation_Position=899; Antisense; GGGCACTCTGTCGAAACGATAGCGA
>probe:Drosophila_2:1623347_at:371:673; Interrogation_Position=918; Antisense; TAGCGAATGCCGGATGCAGCCCATG
>probe:Drosophila_2:1623347_at:373:3; Interrogation_Position=967; Antisense; ATTGGCCATCCCATGGTGTGCAATT
>probe:Drosophila_2:1623347_at:134:509; Interrogation_Position=999; Antisense; GTGCTCCTGCAGTAAGACCCATCGA

Paste this into a BLAST search page for me
AGTGCGTTTTTGTGGAGAACTCCGCACTAAGAGGCTTTGTGGCCTTCCTTCCTTCCTTTGTATCCAGTTCACAATGTGGAGCCTCGATTTGCCTGACAAAGTGCGGCTGCTCCAAAAACTTTGTGCAAGTGCATCAAGGGCTCCGCTTACGCTTACGGTGACACGTGCGAGCACATTCGCCGTGCAAGCTAAACCTGGGTACGACGATCTCGATGCGGTGAACAAAATCTGGAGCGGATCACTTGCGCACGGGCACTCTGTCGAAACGATAGCGATAGCGAATGCCGGATGCAGCCCATGATTGGCCATCCCATGGTGTGCAATTGTGCTCCTGCAGTAAGACCCATCGA

Full Affymetrix probeset data:

Annotations for 1623347_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720