FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623350_at:

>probe:Drosophila_2:1623350_at:522:245; Interrogation_Position=1027; Antisense; AATTCAATGCAGATGCCGCGCAGCA
>probe:Drosophila_2:1623350_at:444:309; Interrogation_Position=1082; Antisense; GCCGCAACCTTTGTGGCTTTTGGGA
>probe:Drosophila_2:1623350_at:148:455; Interrogation_Position=1119; Antisense; GATAAGTATATGCTGCCCTTGTCCG
>probe:Drosophila_2:1623350_at:246:691; Interrogation_Position=1151; Antisense; TATTCCCGCTGTGCTAATAGATCTG
>probe:Drosophila_2:1623350_at:288:31; Interrogation_Position=1176; Antisense; ATAAGGGAGGCTCCCAGATGCCCGT
>probe:Drosophila_2:1623350_at:181:225; Interrogation_Position=1227; Antisense; AAGGAGGACCTCTTCCAGCGCGTTG
>probe:Drosophila_2:1623350_at:244:603; Interrogation_Position=1250; Antisense; TGTTCAGCCGAAATTCATCACCGTT
>probe:Drosophila_2:1623350_at:244:293; Interrogation_Position=1271; Antisense; CGTTAAGAACCTCACATACAGTCGT
>probe:Drosophila_2:1623350_at:505:499; Interrogation_Position=1291; Antisense; GTCGTGAGCATCAGATCTACGCGGA
>probe:Drosophila_2:1623350_at:100:673; Interrogation_Position=1308; Antisense; TACGCGGATGTGGTCCTCTGTGACT
>probe:Drosophila_2:1623350_at:594:285; Interrogation_Position=1325; Antisense; CTGTGACTCTAGGTGCAGTGCATCT
>probe:Drosophila_2:1623350_at:78:347; Interrogation_Position=1344; Antisense; GCATCTGCTGAACTGAAGTTGCTCT
>probe:Drosophila_2:1623350_at:399:249; Interrogation_Position=1473; Antisense; AATTGGCGCGGAGCACTTATTTAAG
>probe:Drosophila_2:1623350_at:403:7; Interrogation_Position=1530; Antisense; ATTGCTCGGTTATGTTTTCATTCAC

Paste this into a BLAST search page for me
AATTCAATGCAGATGCCGCGCAGCAGCCGCAACCTTTGTGGCTTTTGGGAGATAAGTATATGCTGCCCTTGTCCGTATTCCCGCTGTGCTAATAGATCTGATAAGGGAGGCTCCCAGATGCCCGTAAGGAGGACCTCTTCCAGCGCGTTGTGTTCAGCCGAAATTCATCACCGTTCGTTAAGAACCTCACATACAGTCGTGTCGTGAGCATCAGATCTACGCGGATACGCGGATGTGGTCCTCTGTGACTCTGTGACTCTAGGTGCAGTGCATCTGCATCTGCTGAACTGAAGTTGCTCTAATTGGCGCGGAGCACTTATTTAAGATTGCTCGGTTATGTTTTCATTCAC

Full Affymetrix probeset data:

Annotations for 1623350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720