FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623351_at:

>probe:Drosophila_2:1623351_at:2:343; Interrogation_Position=1000; Antisense; GCTTGGCCTTGGAACAATTGCGTCT
>probe:Drosophila_2:1623351_at:213:9; Interrogation_Position=1016; Antisense; ATTGCGTCTGATAAACGCTGCCCTT
>probe:Drosophila_2:1623351_at:471:423; Interrogation_Position=1046; Antisense; GAGACCGACGCTTCATTGCAAAGGC
>probe:Drosophila_2:1623351_at:355:341; Interrogation_Position=1069; Antisense; GCTATGTACGGGATCACATGCCGCA
>probe:Drosophila_2:1623351_at:43:153; Interrogation_Position=1084; Antisense; ACATGCCGCAGGTAGTATTCGTCCG
>probe:Drosophila_2:1623351_at:598:299; Interrogation_Position=1111; Antisense; CGCGTGCCCATCGAATAGACTTTGA
>probe:Drosophila_2:1623351_at:43:327; Interrogation_Position=1216; Antisense; GCGATGCACGGTGCTTAAACACCTT
>probe:Drosophila_2:1623351_at:225:143; Interrogation_Position=1298; Antisense; ACTGGTGCGTCAGTTCCGAGAACGT
>probe:Drosophila_2:1623351_at:284:513; Interrogation_Position=1372; Antisense; GTGAGGCCATCTGGTTTGAGATCCT
>probe:Drosophila_2:1623351_at:401:477; Interrogation_Position=1385; Antisense; GTTTGAGATCCTGGCCGAAAGTGCT
>probe:Drosophila_2:1623351_at:294:251; Interrogation_Position=1412; Antisense; CAAGGCGGCTCCTCATTTCGAAAAG
>probe:Drosophila_2:1623351_at:142:451; Interrogation_Position=1486; Antisense; GATCGGACAATTGGCGCACGTTCTC
>probe:Drosophila_2:1623351_at:42:473; Interrogation_Position=1505; Antisense; GTTCTCTTCCAATGCCGAAAGCTGA
>probe:Drosophila_2:1623351_at:98:577; Interrogation_Position=953; Antisense; GGCGCAACTGTTGAGTGTATGCCAT

Paste this into a BLAST search page for me
GCTTGGCCTTGGAACAATTGCGTCTATTGCGTCTGATAAACGCTGCCCTTGAGACCGACGCTTCATTGCAAAGGCGCTATGTACGGGATCACATGCCGCAACATGCCGCAGGTAGTATTCGTCCGCGCGTGCCCATCGAATAGACTTTGAGCGATGCACGGTGCTTAAACACCTTACTGGTGCGTCAGTTCCGAGAACGTGTGAGGCCATCTGGTTTGAGATCCTGTTTGAGATCCTGGCCGAAAGTGCTCAAGGCGGCTCCTCATTTCGAAAAGGATCGGACAATTGGCGCACGTTCTCGTTCTCTTCCAATGCCGAAAGCTGAGGCGCAACTGTTGAGTGTATGCCAT

Full Affymetrix probeset data:

Annotations for 1623351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720