Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623352_at:

>probe:Drosophila_2:1623352_at:27:701; Interrogation_Position=1000; Antisense; TTTTCCCACTTGGATCGTGCCGGAG
>probe:Drosophila_2:1623352_at:390:381; Interrogation_Position=1046; Antisense; GAACTCTCCGAAAATCGTGCTATTA
>probe:Drosophila_2:1623352_at:631:689; Interrogation_Position=1066; Antisense; TATTATATTCCCCAGCTCTAGCAAA
>probe:Drosophila_2:1623352_at:147:23; Interrogation_Position=1092; Antisense; ATATCCATGTGCCAAACCCGGAGGT
>probe:Drosophila_2:1623352_at:351:471; Interrogation_Position=1115; Antisense; GTTCCCTCAATTCCCATTGATGTGA
>probe:Drosophila_2:1623352_at:185:365; Interrogation_Position=1149; Antisense; GAATCTTCTAAGAGGGAGTTCCCCG
>probe:Drosophila_2:1623352_at:516:717; Interrogation_Position=1167; Antisense; TTCCCCGATTCACACTTGTTGTATA
>probe:Drosophila_2:1623352_at:440:5; Interrogation_Position=1206; Antisense; ATTGTTCAATTGCTCCACCCGAGAT
>probe:Drosophila_2:1623352_at:104:261; Interrogation_Position=1221; Antisense; CACCCGAGATCGTCTTTGTCATAAG
>probe:Drosophila_2:1623352_at:159:371; Interrogation_Position=737; Antisense; GAATGGGATAACTATCCACGCCTCC
>probe:Drosophila_2:1623352_at:565:449; Interrogation_Position=773; Antisense; GATCCCAATGATCCAAACACGAATT
>probe:Drosophila_2:1623352_at:315:657; Interrogation_Position=808; Antisense; TAATGAGTCTAGCACCACTCCACAA
>probe:Drosophila_2:1623352_at:58:201; Interrogation_Position=910; Antisense; AACCGCTCAGCCAACGAAGGATACG
>probe:Drosophila_2:1623352_at:641:607; Interrogation_Position=939; Antisense; TAATAGGAACCAATCGACCGCCGTT

Paste this into a BLAST search page for me
TTTTCCCACTTGGATCGTGCCGGAGGAACTCTCCGAAAATCGTGCTATTATATTATATTCCCCAGCTCTAGCAAAATATCCATGTGCCAAACCCGGAGGTGTTCCCTCAATTCCCATTGATGTGAGAATCTTCTAAGAGGGAGTTCCCCGTTCCCCGATTCACACTTGTTGTATAATTGTTCAATTGCTCCACCCGAGATCACCCGAGATCGTCTTTGTCATAAGGAATGGGATAACTATCCACGCCTCCGATCCCAATGATCCAAACACGAATTTAATGAGTCTAGCACCACTCCACAAAACCGCTCAGCCAACGAAGGATACGTAATAGGAACCAATCGACCGCCGTT

Full Affymetrix probeset data:

Annotations for 1623352_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime