FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623353_at:

>probe:Drosophila_2:1623353_at:254:85; Interrogation_Position=1508; Antisense; AGTCGATGCTTACCGCGTGGGCAAA
>probe:Drosophila_2:1623353_at:644:585; Interrogation_Position=1573; Antisense; TGGACTTCCCTAACGTGCAACACGT
>probe:Drosophila_2:1623353_at:262:709; Interrogation_Position=1600; Antisense; TTAACTACGACATGCCGGACGATAT
>probe:Drosophila_2:1623353_at:152:193; Interrogation_Position=1629; Antisense; AACTATGTGCATCGTATTGGCCGCA
>probe:Drosophila_2:1623353_at:375:355; Interrogation_Position=1651; Antisense; GCACAGGTCGTTCCAACACTAAGGG
>probe:Drosophila_2:1623353_at:288:223; Interrogation_Position=1671; Antisense; AAGGGATTGGCTACGACGCTGATAA
>probe:Drosophila_2:1623353_at:174:615; Interrogation_Position=1729; Antisense; TGAAGCACCTGCTAATCGAGGGCAA
>probe:Drosophila_2:1623353_at:516:81; Interrogation_Position=1747; Antisense; AGGGCAAGCAAGAGGTCCCGGACTT
>probe:Drosophila_2:1623353_at:21:555; Interrogation_Position=1775; Antisense; GGACGAACTGGCACCTGAGACCGAA
>probe:Drosophila_2:1623353_at:14:413; Interrogation_Position=1812; Antisense; GACCTGGGTGACTCGCATGGCTGCA
>probe:Drosophila_2:1623353_at:152:83; Interrogation_Position=1870; Antisense; AGTGCCCAAAACTTGAGGCTGTTCA
>probe:Drosophila_2:1623353_at:301:341; Interrogation_Position=1905; Antisense; GCTTCAAACATAGGACGTCGCGACT
>probe:Drosophila_2:1623353_at:91:673; Interrogation_Position=1929; Antisense; TACCTATCTAACACCGCTGCGGATT
>probe:Drosophila_2:1623353_at:634:319; Interrogation_Position=1944; Antisense; GCTGCGGATTACTAAACCACTACCA

Paste this into a BLAST search page for me
AGTCGATGCTTACCGCGTGGGCAAATGGACTTCCCTAACGTGCAACACGTTTAACTACGACATGCCGGACGATATAACTATGTGCATCGTATTGGCCGCAGCACAGGTCGTTCCAACACTAAGGGAAGGGATTGGCTACGACGCTGATAATGAAGCACCTGCTAATCGAGGGCAAAGGGCAAGCAAGAGGTCCCGGACTTGGACGAACTGGCACCTGAGACCGAAGACCTGGGTGACTCGCATGGCTGCAAGTGCCCAAAACTTGAGGCTGTTCAGCTTCAAACATAGGACGTCGCGACTTACCTATCTAACACCGCTGCGGATTGCTGCGGATTACTAAACCACTACCA

Full Affymetrix probeset data:

Annotations for 1623353_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720