FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623355_at:

>probe:Drosophila_2:1623355_at:21:143; Interrogation_Position=1029; Antisense; ACTGGTGGCTCGTCTGGATATCAAT
>probe:Drosophila_2:1623355_at:649:543; Interrogation_Position=1044; Antisense; GGATATCAATATCTGCGCTCCACTC
>probe:Drosophila_2:1623355_at:490:251; Interrogation_Position=1082; Antisense; CAAGGTGTTTCTGGATCTGTTCAAT
>probe:Drosophila_2:1623355_at:335:603; Interrogation_Position=1099; Antisense; TGTTCAATCTGTCCACTTTTCTGAT
>probe:Drosophila_2:1623355_at:706:235; Interrogation_Position=1192; Antisense; AATCGGCAGGGTATCCAATTGGTCA
>probe:Drosophila_2:1623355_at:432:341; Interrogation_Position=1224; Antisense; GCTATGCGTTGTTTGTTCTGCCTAC
>probe:Drosophila_2:1623355_at:302:309; Interrogation_Position=1243; Antisense; GCCTACTGTTTTGTCGTTTTGGTGT
>probe:Drosophila_2:1623355_at:302:181; Interrogation_Position=751; Antisense; AAAACTACCGCCTCATGGACATTGA
>probe:Drosophila_2:1623355_at:452:435; Interrogation_Position=786; Antisense; GAGGTGTATCGCTCCATCTTTGATC
>probe:Drosophila_2:1623355_at:184:693; Interrogation_Position=804; Antisense; TTTGATCCGGCAGTGCACGATGCAC
>probe:Drosophila_2:1623355_at:535:529; Interrogation_Position=841; Antisense; GGGATCGCCGGTTTAGCCATCGTGC
>probe:Drosophila_2:1623355_at:10:127; Interrogation_Position=875; Antisense; AGCCATCATGATCACCTTCTATAGG
>probe:Drosophila_2:1623355_at:415:547; Interrogation_Position=899; Antisense; GGATGAACCCAGATTCAGCCAGCCA
>probe:Drosophila_2:1623355_at:284:535; Interrogation_Position=995; Antisense; GGTGCAACGCATGATTGGATCCCAA

Paste this into a BLAST search page for me
ACTGGTGGCTCGTCTGGATATCAATGGATATCAATATCTGCGCTCCACTCCAAGGTGTTTCTGGATCTGTTCAATTGTTCAATCTGTCCACTTTTCTGATAATCGGCAGGGTATCCAATTGGTCAGCTATGCGTTGTTTGTTCTGCCTACGCCTACTGTTTTGTCGTTTTGGTGTAAAACTACCGCCTCATGGACATTGAGAGGTGTATCGCTCCATCTTTGATCTTTGATCCGGCAGTGCACGATGCACGGGATCGCCGGTTTAGCCATCGTGCAGCCATCATGATCACCTTCTATAGGGGATGAACCCAGATTCAGCCAGCCAGGTGCAACGCATGATTGGATCCCAA

Full Affymetrix probeset data:

Annotations for 1623355_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720