FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623356_at:

>probe:Drosophila_2:1623356_at:353:407; Interrogation_Position=340; Antisense; GACGTGAACAGCCACTGGGTGATCA
>probe:Drosophila_2:1623356_at:278:297; Interrogation_Position=368; Antisense; CGCAGACCGGCGAGCTTTGTGAAAG
>probe:Drosophila_2:1623356_at:274:587; Interrogation_Position=428; Antisense; TGGAGCACCTGTCCACCAAGAAGAA
>probe:Drosophila_2:1623356_at:676:669; Interrogation_Position=508; Antisense; TACGGAACGGATGGACTCGGCGACA
>probe:Drosophila_2:1623356_at:379:433; Interrogation_Position=547; Antisense; GAGGTGGTCTGCTCCAACGAGAACT
>probe:Drosophila_2:1623356_at:79:197; Interrogation_Position=568; Antisense; AACTGGATGCGCAGTGCCCACGTTA
>probe:Drosophila_2:1623356_at:199:43; Interrogation_Position=604; Antisense; ATCGACACCGGCATGTACCTGGGCA
>probe:Drosophila_2:1623356_at:677:55; Interrogation_Position=667; Antisense; ATGGAAATCGTTGGCGTCCACAAGC
>probe:Drosophila_2:1623356_at:298:587; Interrogation_Position=709; Antisense; TGGACCACGGCGGAGGGCCTCTTTA
>probe:Drosophila_2:1623356_at:153:579; Interrogation_Position=724; Antisense; GGCCTCTTTATCGTGCCCAAGGAGA
>probe:Drosophila_2:1623356_at:539:101; Interrogation_Position=749; Antisense; AGAGCTCAACGCACGACGAGTACGC
>probe:Drosophila_2:1623356_at:205:429; Interrogation_Position=766; Antisense; GAGTACGCCCACTCGGAGCTGTAGT
>probe:Drosophila_2:1623356_at:265:601; Interrogation_Position=785; Antisense; TGTAGTGCTCCCTAAGGACCTCGAC
>probe:Drosophila_2:1623356_at:529:405; Interrogation_Position=807; Antisense; GACTGCTGCAGTTTCATACTACTAT

Paste this into a BLAST search page for me
GACGTGAACAGCCACTGGGTGATCACGCAGACCGGCGAGCTTTGTGAAAGTGGAGCACCTGTCCACCAAGAAGAATACGGAACGGATGGACTCGGCGACAGAGGTGGTCTGCTCCAACGAGAACTAACTGGATGCGCAGTGCCCACGTTAATCGACACCGGCATGTACCTGGGCAATGGAAATCGTTGGCGTCCACAAGCTGGACCACGGCGGAGGGCCTCTTTAGGCCTCTTTATCGTGCCCAAGGAGAAGAGCTCAACGCACGACGAGTACGCGAGTACGCCCACTCGGAGCTGTAGTTGTAGTGCTCCCTAAGGACCTCGACGACTGCTGCAGTTTCATACTACTAT

Full Affymetrix probeset data:

Annotations for 1623356_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720