FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623357_at:

>probe:Drosophila_2:1623357_at:74:513; Interrogation_Position=1016; Antisense; GTGATCCCAGAAAGACCTTCCGTTT
>probe:Drosophila_2:1623357_at:460:65; Interrogation_Position=1042; Antisense; ATGGTCTGCCTGAAGAAACTCCTGC
>probe:Drosophila_2:1623357_at:3:517; Interrogation_Position=1144; Antisense; GTGTCCAATGACATAGCCGTGCCAA
>probe:Drosophila_2:1623357_at:469:227; Interrogation_Position=1167; Antisense; AATGGCCAGTAGCTCCGTTTATCGG
>probe:Drosophila_2:1623357_at:238:685; Interrogation_Position=1186; Antisense; TATCGGATCGATTTTCTGGACAAAC
>probe:Drosophila_2:1623357_at:647:177; Interrogation_Position=1308; Antisense; AAACTTCACAGAACTCGTGCTGAAC
>probe:Drosophila_2:1623357_at:722:349; Interrogation_Position=1335; Antisense; GCAGACCAAGGTGCTCATCGAAGAG
>probe:Drosophila_2:1623357_at:135:179; Interrogation_Position=1365; Antisense; AAACAAAGTGACCTGCCTCAACCAT
>probe:Drosophila_2:1623357_at:310:627; Interrogation_Position=1396; Antisense; TCCACCAGCGTGCAGGGCAAACTTA
>probe:Drosophila_2:1623357_at:437:709; Interrogation_Position=1418; Antisense; TTAAGAAGGTGCTTGGCGTGCAGCC
>probe:Drosophila_2:1623357_at:406:125; Interrogation_Position=1439; Antisense; AGCCGCACGATCAGCCGATTATTAA
>probe:Drosophila_2:1623357_at:395:3; Interrogation_Position=1459; Antisense; ATTAACTACTGGAGCACACACCTTC
>probe:Drosophila_2:1623357_at:679:89; Interrogation_Position=1487; Antisense; AGTACAACCGATTACCGCACAGATT
>probe:Drosophila_2:1623357_at:641:181; Interrogation_Position=1540; Antisense; AAAACTCTTTTATTGCCGTGCGATG

Paste this into a BLAST search page for me
GTGATCCCAGAAAGACCTTCCGTTTATGGTCTGCCTGAAGAAACTCCTGCGTGTCCAATGACATAGCCGTGCCAAAATGGCCAGTAGCTCCGTTTATCGGTATCGGATCGATTTTCTGGACAAACAAACTTCACAGAACTCGTGCTGAACGCAGACCAAGGTGCTCATCGAAGAGAAACAAAGTGACCTGCCTCAACCATTCCACCAGCGTGCAGGGCAAACTTATTAAGAAGGTGCTTGGCGTGCAGCCAGCCGCACGATCAGCCGATTATTAAATTAACTACTGGAGCACACACCTTCAGTACAACCGATTACCGCACAGATTAAAACTCTTTTATTGCCGTGCGATG

Full Affymetrix probeset data:

Annotations for 1623357_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720