Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623358_at:

>probe:Drosophila_2:1623358_at:564:271; Interrogation_Position=106; Antisense; CATATCAAGGATGGCCAACCCACGA
>probe:Drosophila_2:1623358_at:330:67; Interrogation_Position=13; Antisense; ATGGCTGATAGTGCGCTCATCGAAA
>probe:Drosophila_2:1623358_at:74:69; Interrogation_Position=133; Antisense; ATGGCTAATCTGGAGCGCTGCAACT
>probe:Drosophila_2:1623358_at:597:531; Interrogation_Position=164; Antisense; GGGTGCACGTGGACTGCCAGCTAAA
>probe:Drosophila_2:1623358_at:630:663; Interrogation_Position=185; Antisense; TAAAGATGCCGCTGCGTGCCGAGAT
>probe:Drosophila_2:1623358_at:65:429; Interrogation_Position=205; Antisense; GAGATTCCGGTAGGCCATGCTAGCG
>probe:Drosophila_2:1623358_at:723:667; Interrogation_Position=232; Antisense; TACGGTCCAGTTCTGTGCGGCACCA
>probe:Drosophila_2:1623358_at:253:623; Interrogation_Position=247; Antisense; TGCGGCACCATCCTGCTAGGTTGGT
>probe:Drosophila_2:1623358_at:72:679; Interrogation_Position=263; Antisense; TAGGTTGGTCTCTGGCCCTGTGGAC
>probe:Drosophila_2:1623358_at:283:595; Interrogation_Position=281; Antisense; TGTGGACCATCATCCACTCGATGGC
>probe:Drosophila_2:1623358_at:322:199; Interrogation_Position=334; Antisense; AACGAGCAGCGACTTCTGCAGCAAA
>probe:Drosophila_2:1623358_at:587:31; Interrogation_Position=59; Antisense; ATAAGCTGTACTGCCTGAATGCGCC
>probe:Drosophila_2:1623358_at:73:615; Interrogation_Position=74; Antisense; TGAATGCGCCGGAAAGCCGTTTCGA
>probe:Drosophila_2:1623358_at:493:311; Interrogation_Position=89; Antisense; GCCGTTTCGACGAGAACCATATCAA

Paste this into a BLAST search page for me
CATATCAAGGATGGCCAACCCACGAATGGCTGATAGTGCGCTCATCGAAAATGGCTAATCTGGAGCGCTGCAACTGGGTGCACGTGGACTGCCAGCTAAATAAAGATGCCGCTGCGTGCCGAGATGAGATTCCGGTAGGCCATGCTAGCGTACGGTCCAGTTCTGTGCGGCACCATGCGGCACCATCCTGCTAGGTTGGTTAGGTTGGTCTCTGGCCCTGTGGACTGTGGACCATCATCCACTCGATGGCAACGAGCAGCGACTTCTGCAGCAAAATAAGCTGTACTGCCTGAATGCGCCTGAATGCGCCGGAAAGCCGTTTCGAGCCGTTTCGACGAGAACCATATCAA

Full Affymetrix probeset data:

Annotations for 1623358_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime