FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623359_at:

>probe:Drosophila_2:1623359_at:570:211; Interrogation_Position=3064; Antisense; AAGAAAGTTCGCCTACCTCGGCGCT
>probe:Drosophila_2:1623359_at:56:297; Interrogation_Position=3093; Antisense; CGCAGCTTGGTGGTGGCTAATACCA
>probe:Drosophila_2:1623359_at:212:337; Interrogation_Position=3108; Antisense; GCTAATACCAAAACCTCCTTTCAGG
>probe:Drosophila_2:1623359_at:715:689; Interrogation_Position=3126; Antisense; TTTCAGGACCTTCTTCAGCAGGCCA
>probe:Drosophila_2:1623359_at:92:649; Interrogation_Position=3140; Antisense; TCAGCAGGCCAGTCAGACGGTGCAG
>probe:Drosophila_2:1623359_at:653:367; Interrogation_Position=3177; Antisense; GAATCCTCGGAGACAGCAGCCACTA
>probe:Drosophila_2:1623359_at:159:313; Interrogation_Position=3195; Antisense; GCCACTATTGCTGCGGATGATTTTT
>probe:Drosophila_2:1623359_at:289:443; Interrogation_Position=3210; Antisense; GATGATTTTTCGCTGGACAACCTTA
>probe:Drosophila_2:1623359_at:508:559; Interrogation_Position=3224; Antisense; GGACAACCTTAAGCGAGAGCCAGTG
>probe:Drosophila_2:1623359_at:417:633; Interrogation_Position=3251; Antisense; TCCCGCGGAGGATCACAATGACATA
>probe:Drosophila_2:1623359_at:500:453; Interrogation_Position=3261; Antisense; GATCACAATGACATACTCGGTGTTT
>probe:Drosophila_2:1623359_at:724:637; Interrogation_Position=3277; Antisense; TCGGTGTTTAAGACCAGGCCAAAGA
>probe:Drosophila_2:1623359_at:61:269; Interrogation_Position=3291; Antisense; CAGGCCAAAGAAATTTCCGAGTATT
>probe:Drosophila_2:1623359_at:605:51; Interrogation_Position=3389; Antisense; ATGCACTTATAATGTTGCGTTAAAC

Paste this into a BLAST search page for me
AAGAAAGTTCGCCTACCTCGGCGCTCGCAGCTTGGTGGTGGCTAATACCAGCTAATACCAAAACCTCCTTTCAGGTTTCAGGACCTTCTTCAGCAGGCCATCAGCAGGCCAGTCAGACGGTGCAGGAATCCTCGGAGACAGCAGCCACTAGCCACTATTGCTGCGGATGATTTTTGATGATTTTTCGCTGGACAACCTTAGGACAACCTTAAGCGAGAGCCAGTGTCCCGCGGAGGATCACAATGACATAGATCACAATGACATACTCGGTGTTTTCGGTGTTTAAGACCAGGCCAAAGACAGGCCAAAGAAATTTCCGAGTATTATGCACTTATAATGTTGCGTTAAAC

Full Affymetrix probeset data:

Annotations for 1623359_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720