FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623360_at:

>probe:Drosophila_2:1623360_at:364:683; Interrogation_Position=111; Antisense; TATCATTGCCAACACGATCAACAGC
>probe:Drosophila_2:1623360_at:56:223; Interrogation_Position=14; Antisense; AAGGGCATGGCACAAATAGCACCAT
>probe:Drosophila_2:1623360_at:4:159; Interrogation_Position=239; Antisense; ACAACGACATGGACGCCGAGCAGTT
>probe:Drosophila_2:1623360_at:593:113; Interrogation_Position=257; Antisense; AGCAGTTGTCCCTCTTCGCCGGAAA
>probe:Drosophila_2:1623360_at:293:275; Interrogation_Position=270; Antisense; CTTCGCCGGAAACGCCCAGATCGAG
>probe:Drosophila_2:1623360_at:320:551; Interrogation_Position=294; Antisense; GGAGATGATGGCACTCGGCCTAGCC
>probe:Drosophila_2:1623360_at:60:677; Interrogation_Position=30; Antisense; TAGCACCATAAATACCATCGACGCC
>probe:Drosophila_2:1623360_at:247:673; Interrogation_Position=314; Antisense; TAGCCGCTGATAGAGCCATCGGTGC
>probe:Drosophila_2:1623360_at:86:309; Interrogation_Position=329; Antisense; CCATCGGTGCCAATGGCGGCAACAA
>probe:Drosophila_2:1623360_at:354:449; Interrogation_Position=379; Antisense; GATCCTGGCCTGATGCGACGCATGG
>probe:Drosophila_2:1623360_at:278:513; Interrogation_Position=406; Antisense; GTGGGCGGATTTTGCAAGATTTGCA
>probe:Drosophila_2:1623360_at:481:215; Interrogation_Position=421; Antisense; AAGATTTGCAACGTGGTCTGCCATG
>probe:Drosophila_2:1623360_at:114:519; Interrogation_Position=433; Antisense; GTGGTCTGCCATGTGCTGCACGACT
>probe:Drosophila_2:1623360_at:370:103; Interrogation_Position=479; Antisense; AGAGCTGTCACACCCACTGGAGGTA

Paste this into a BLAST search page for me
TATCATTGCCAACACGATCAACAGCAAGGGCATGGCACAAATAGCACCATACAACGACATGGACGCCGAGCAGTTAGCAGTTGTCCCTCTTCGCCGGAAACTTCGCCGGAAACGCCCAGATCGAGGGAGATGATGGCACTCGGCCTAGCCTAGCACCATAAATACCATCGACGCCTAGCCGCTGATAGAGCCATCGGTGCCCATCGGTGCCAATGGCGGCAACAAGATCCTGGCCTGATGCGACGCATGGGTGGGCGGATTTTGCAAGATTTGCAAAGATTTGCAACGTGGTCTGCCATGGTGGTCTGCCATGTGCTGCACGACTAGAGCTGTCACACCCACTGGAGGTA

Full Affymetrix probeset data:

Annotations for 1623360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720