FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623363_at:

>probe:Drosophila_2:1623363_at:524:687; Interrogation_Position=1682; Antisense; TATATCTTTGTGACAGCTCGCGACG
>probe:Drosophila_2:1623363_at:132:239; Interrogation_Position=1714; Antisense; AATCAATGTGGCTGGCCATCGCTTG
>probe:Drosophila_2:1623363_at:38:83; Interrogation_Position=1821; Antisense; AGGGACAGGTACCACTGTGCCTGTA
>probe:Drosophila_2:1623363_at:257:597; Interrogation_Position=1836; Antisense; TGTGCCTGTACATTCCGGTGGAGAA
>probe:Drosophila_2:1623363_at:664:447; Interrogation_Position=1874; Antisense; GATGCCAAGCTGTCGACGGAGATCA
>probe:Drosophila_2:1623363_at:87:273; Interrogation_Position=1897; Antisense; CATCAAGCTGATCCGCGACGTCGTA
>probe:Drosophila_2:1623363_at:586:145; Interrogation_Position=1973; Antisense; ACTCGATCCGGTAAGACGATGCGCA
>probe:Drosophila_2:1623363_at:206:71; Interrogation_Position=1998; Antisense; AGGCGATGGCGGACTTTGCCCGCAA
>probe:Drosophila_2:1623363_at:228:325; Interrogation_Position=2042; Antisense; GCGACTATCGATGATGCCAGCGTGT
>probe:Drosophila_2:1623363_at:606:313; Interrogation_Position=2057; Antisense; GCCAGCGTGTTCATCGAGATCCGGA
>probe:Drosophila_2:1623363_at:385:447; Interrogation_Position=2074; Antisense; GATCCGGAGGGCTCTGAACCAGTTG
>probe:Drosophila_2:1623363_at:588:55; Interrogation_Position=2108; Antisense; ATGACCGCACCGGATCCGATTGTGG
>probe:Drosophila_2:1623363_at:306:729; Interrogation_Position=2127; Antisense; TTGTGGCCAAGTTACTCGACTGATG
>probe:Drosophila_2:1623363_at:591:705; Interrogation_Position=2178; Antisense; TTAGCTTGTACGATACGATTCCCAA

Paste this into a BLAST search page for me
TATATCTTTGTGACAGCTCGCGACGAATCAATGTGGCTGGCCATCGCTTGAGGGACAGGTACCACTGTGCCTGTATGTGCCTGTACATTCCGGTGGAGAAGATGCCAAGCTGTCGACGGAGATCACATCAAGCTGATCCGCGACGTCGTAACTCGATCCGGTAAGACGATGCGCAAGGCGATGGCGGACTTTGCCCGCAAGCGACTATCGATGATGCCAGCGTGTGCCAGCGTGTTCATCGAGATCCGGAGATCCGGAGGGCTCTGAACCAGTTGATGACCGCACCGGATCCGATTGTGGTTGTGGCCAAGTTACTCGACTGATGTTAGCTTGTACGATACGATTCCCAA

Full Affymetrix probeset data:

Annotations for 1623363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720