FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623364_at:

>probe:Drosophila_2:1623364_at:626:71; Interrogation_Position=122; Antisense; AGGCACCGCCCAGTTATGATAGCGC
>probe:Drosophila_2:1623364_at:245:705; Interrogation_Position=135; Antisense; TTATGATAGCGCACCGCAGCAGGTC
>probe:Drosophila_2:1623364_at:360:683; Interrogation_Position=160; Antisense; TATCCTCAGCTCCATCAGGGACAGG
>probe:Drosophila_2:1623364_at:543:433; Interrogation_Position=185; Antisense; GAGTGATATTGCAGGCTCCACCCAA
>probe:Drosophila_2:1623364_at:293:223; Interrogation_Position=271; Antisense; AAGGTGGAGTTCGAGCCCAGCACCA
>probe:Drosophila_2:1623364_at:682:727; Interrogation_Position=307; Antisense; TTGGCCCTACTCATCTGCATGCTGG
>probe:Drosophila_2:1623364_at:189:129; Interrogation_Position=397; Antisense; ACCAGCTGTGGAGCCTACGTGGGCA
>probe:Drosophila_2:1623364_at:440:671; Interrogation_Position=412; Antisense; TACGTGGGCACCTACAAGAACTAGA
>probe:Drosophila_2:1623364_at:647:219; Interrogation_Position=436; Antisense; AAGTGCTATCTCAACACCAAATATT
>probe:Drosophila_2:1623364_at:332:543; Interrogation_Position=465; Antisense; GGATAGATCCCACTTTGTATCTCCA
>probe:Drosophila_2:1623364_at:180:483; Interrogation_Position=481; Antisense; GTATCTCCACACCTATTGATGGGAT
>probe:Drosophila_2:1623364_at:697:35; Interrogation_Position=504; Antisense; ATCAGATTTGGCACGAATATTCACG
>probe:Drosophila_2:1623364_at:427:13; Interrogation_Position=522; Antisense; ATTCACGAAATACAACTCTGGTTCA
>probe:Drosophila_2:1623364_at:300:137; Interrogation_Position=89; Antisense; ACGAGAATATGCAGCCTCAGGCTCC

Paste this into a BLAST search page for me
AGGCACCGCCCAGTTATGATAGCGCTTATGATAGCGCACCGCAGCAGGTCTATCCTCAGCTCCATCAGGGACAGGGAGTGATATTGCAGGCTCCACCCAAAAGGTGGAGTTCGAGCCCAGCACCATTGGCCCTACTCATCTGCATGCTGGACCAGCTGTGGAGCCTACGTGGGCATACGTGGGCACCTACAAGAACTAGAAAGTGCTATCTCAACACCAAATATTGGATAGATCCCACTTTGTATCTCCAGTATCTCCACACCTATTGATGGGATATCAGATTTGGCACGAATATTCACGATTCACGAAATACAACTCTGGTTCAACGAGAATATGCAGCCTCAGGCTCC

Full Affymetrix probeset data:

Annotations for 1623364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720