FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623365_at:

>probe:Drosophila_2:1623365_at:130:115; Interrogation_Position=1003; Antisense; AGCAGACGCATCACCAGCAGTTAGA
>probe:Drosophila_2:1623365_at:235:475; Interrogation_Position=1022; Antisense; GTTAGAGACTCAATTCGCGAATACT
>probe:Drosophila_2:1623365_at:333:609; Interrogation_Position=1065; Antisense; TGAGAATGCTCCGAACCCCTTAAGA
>probe:Drosophila_2:1623365_at:187:435; Interrogation_Position=1088; Antisense; GAGGGCTTTCACTTGAGAGATTTCA
>probe:Drosophila_2:1623365_at:196:399; Interrogation_Position=1127; Antisense; GACACGCTCGAATAATTATGCTCCT
>probe:Drosophila_2:1623365_at:409:251; Interrogation_Position=668; Antisense; CAAGTCCTACTTTATCATGAACGGG
>probe:Drosophila_2:1623365_at:127:631; Interrogation_Position=700; Antisense; TCCGGTTCCGTGGATGGATAGACCT
>probe:Drosophila_2:1623365_at:558:675; Interrogation_Position=718; Antisense; TAGACCTGGAACGACTGGACGGAGT
>probe:Drosophila_2:1623365_at:524:713; Interrogation_Position=790; Antisense; TTCTGCGGGATCAGATCGATCGCTA
>probe:Drosophila_2:1623365_at:228:161; Interrogation_Position=814; Antisense; ACAACCAGCGACTGCGTGAGTTCGA
>probe:Drosophila_2:1623365_at:142:429; Interrogation_Position=831; Antisense; GAGTTCGAGGACACTAAGCGCGCCT
>probe:Drosophila_2:1623365_at:540:321; Interrogation_Position=850; Antisense; GCGCCTACCGTGACAATCGACAGGA
>probe:Drosophila_2:1623365_at:340:347; Interrogation_Position=931; Antisense; GCATGTGGCGTCGTTAGTTGGACCT
>probe:Drosophila_2:1623365_at:403:677; Interrogation_Position=945; Antisense; TAGTTGGACCTGTGGACGGCTCCTG

Paste this into a BLAST search page for me
AGCAGACGCATCACCAGCAGTTAGAGTTAGAGACTCAATTCGCGAATACTTGAGAATGCTCCGAACCCCTTAAGAGAGGGCTTTCACTTGAGAGATTTCAGACACGCTCGAATAATTATGCTCCTCAAGTCCTACTTTATCATGAACGGGTCCGGTTCCGTGGATGGATAGACCTTAGACCTGGAACGACTGGACGGAGTTTCTGCGGGATCAGATCGATCGCTAACAACCAGCGACTGCGTGAGTTCGAGAGTTCGAGGACACTAAGCGCGCCTGCGCCTACCGTGACAATCGACAGGAGCATGTGGCGTCGTTAGTTGGACCTTAGTTGGACCTGTGGACGGCTCCTG

Full Affymetrix probeset data:

Annotations for 1623365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720