FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623366_at:

>probe:Drosophila_2:1623366_at:211:713; Interrogation_Position=472; Antisense; TTCATTCTTCGCAACGTGATTGATC
>probe:Drosophila_2:1623366_at:578:533; Interrogation_Position=510; Antisense; GGTGGTCTACGAGCTGTATGATCCT
>probe:Drosophila_2:1623366_at:647:333; Interrogation_Position=522; Antisense; GCTGTATGATCCTACCATCCTAAAG
>probe:Drosophila_2:1623366_at:248:55; Interrogation_Position=578; Antisense; ATGACAGTCTTTTCTACCTGCGGGA
>probe:Drosophila_2:1623366_at:48:411; Interrogation_Position=601; Antisense; GACGCTCTTCCGGAGTACAGTACTT
>probe:Drosophila_2:1623366_at:578:57; Interrogation_Position=629; Antisense; ATGAGAACATGGAGGCCGAGCCGCT
>probe:Drosophila_2:1623366_at:75:141; Interrogation_Position=683; Antisense; ACATTAAGGTGGTGCTCCGTCCGCG
>probe:Drosophila_2:1623366_at:627:39; Interrogation_Position=737; Antisense; ATCTGCGTGGTGTGGCCAACATCGA
>probe:Drosophila_2:1623366_at:484:183; Interrogation_Position=771; Antisense; AAAAGACAAGCATCGCCTGTCGGCG
>probe:Drosophila_2:1623366_at:347:597; Interrogation_Position=788; Antisense; TGTCGGCGGCCAAGGTGCAGAAACC
>probe:Drosophila_2:1623366_at:662:445; Interrogation_Position=831; Antisense; GATGAAGGACTACCGCAGCTCGATT
>probe:Drosophila_2:1623366_at:570:37; Interrogation_Position=877; Antisense; ATCTTCGCCGAGGTGCACACGGAAC
>probe:Drosophila_2:1623366_at:425:205; Interrogation_Position=940; Antisense; AAGCGCACTTTCATTAAGCCCAAGC
>probe:Drosophila_2:1623366_at:80:321; Interrogation_Position=957; Antisense; GCCCAAGCAGCTGGCGTAATTGCAT

Paste this into a BLAST search page for me
TTCATTCTTCGCAACGTGATTGATCGGTGGTCTACGAGCTGTATGATCCTGCTGTATGATCCTACCATCCTAAAGATGACAGTCTTTTCTACCTGCGGGAGACGCTCTTCCGGAGTACAGTACTTATGAGAACATGGAGGCCGAGCCGCTACATTAAGGTGGTGCTCCGTCCGCGATCTGCGTGGTGTGGCCAACATCGAAAAAGACAAGCATCGCCTGTCGGCGTGTCGGCGGCCAAGGTGCAGAAACCGATGAAGGACTACCGCAGCTCGATTATCTTCGCCGAGGTGCACACGGAACAAGCGCACTTTCATTAAGCCCAAGCGCCCAAGCAGCTGGCGTAATTGCAT

Full Affymetrix probeset data:

Annotations for 1623366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720