FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623370_at:

>probe:Drosophila_2:1623370_at:92:321; Interrogation_Position=1087; Antisense; GCCCCGTCTGCAATGCTGGTTTTAA
>probe:Drosophila_2:1623370_at:86:495; Interrogation_Position=1138; Antisense; GTCAGACACATGGTGAGCCCAAGTT
>probe:Drosophila_2:1623370_at:57:481; Interrogation_Position=1160; Antisense; GTTTGAGTGCAATGTCTGCGGCAAA
>probe:Drosophila_2:1623370_at:358:173; Interrogation_Position=1184; Antisense; AAAGCTGCAGACACGGGCGATTCTT
>probe:Drosophila_2:1623370_at:456:61; Interrogation_Position=1222; Antisense; ATGTGCACACGGATGAGCGGCGCTT
>probe:Drosophila_2:1623370_at:667:567; Interrogation_Position=1263; Antisense; GGCAGCGGCTGTAAGAACTCCACGG
>probe:Drosophila_2:1623370_at:78:383; Interrogation_Position=1277; Antisense; GAACTCCACGGCCTTGAAGATCCAT
>probe:Drosophila_2:1623370_at:295:615; Interrogation_Position=1291; Antisense; TGAAGATCCATCTCCTTGGACACAC
>probe:Drosophila_2:1623370_at:375:307; Interrogation_Position=1318; Antisense; GCCTCAGACCCTACGTATGCAAGTA
>probe:Drosophila_2:1623370_at:339:195; Interrogation_Position=1371; Antisense; AACTGTCGCTCCCACAAATGGAAAA
>probe:Drosophila_2:1623370_at:454:179; Interrogation_Position=1394; Antisense; AAAACATCCGGAACTGGCGTCCAAG
>probe:Drosophila_2:1623370_at:652:391; Interrogation_Position=1425; Antisense; GAAACCGAATCTTCACGTGTTCCAG
>probe:Drosophila_2:1623370_at:467:31; Interrogation_Position=1476; Antisense; ATAACTCGCGAGATGGCCAAGGCCA
>probe:Drosophila_2:1623370_at:445:705; Interrogation_Position=1591; Antisense; TTAAACACACAACTGCCCTTTTTGC

Paste this into a BLAST search page for me
GCCCCGTCTGCAATGCTGGTTTTAAGTCAGACACATGGTGAGCCCAAGTTGTTTGAGTGCAATGTCTGCGGCAAAAAAGCTGCAGACACGGGCGATTCTTATGTGCACACGGATGAGCGGCGCTTGGCAGCGGCTGTAAGAACTCCACGGGAACTCCACGGCCTTGAAGATCCATTGAAGATCCATCTCCTTGGACACACGCCTCAGACCCTACGTATGCAAGTAAACTGTCGCTCCCACAAATGGAAAAAAAACATCCGGAACTGGCGTCCAAGGAAACCGAATCTTCACGTGTTCCAGATAACTCGCGAGATGGCCAAGGCCATTAAACACACAACTGCCCTTTTTGC

Full Affymetrix probeset data:

Annotations for 1623370_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720