FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623371_at:

>probe:Drosophila_2:1623371_at:257:361; Interrogation_Position=110; Antisense; GCAATCTGGGTAACTTCTTCACCGA
>probe:Drosophila_2:1623371_at:98:447; Interrogation_Position=133; Antisense; GATGCTATGCTTCATGCGTTTGTCA
>probe:Drosophila_2:1623371_at:446:535; Interrogation_Position=15; Antisense; GGTGCCTTGGCAACTCGAGATGAAA
>probe:Drosophila_2:1623371_at:491:251; Interrogation_Position=156; Antisense; CAAGGATGCTTCATCGTCGTCTGAA
>probe:Drosophila_2:1623371_at:620:527; Interrogation_Position=188; Antisense; GGAGTAACGTGACCATTGCCTTGAC
>probe:Drosophila_2:1623371_at:589:383; Interrogation_Position=221; Antisense; GAACTTTTCGAGTGCCTATTCCAGC
>probe:Drosophila_2:1623371_at:723:209; Interrogation_Position=262; Antisense; AAGCAATTGTTTGCCATGTGCCCAT
>probe:Drosophila_2:1623371_at:553:609; Interrogation_Position=302; Antisense; TGACCCTCAGTCTGCGTGGTAAGCA
>probe:Drosophila_2:1623371_at:160:99; Interrogation_Position=32; Antisense; AGATGAAACCCATTGCCGAGCGGAC
>probe:Drosophila_2:1623371_at:462:475; Interrogation_Position=425; Antisense; GTTACGATTTGAACGCCGATCAGCG
>probe:Drosophila_2:1623371_at:371:493; Interrogation_Position=466; Antisense; GTAAGATGCTCCAAGTGCCTGGTGC
>probe:Drosophila_2:1623371_at:554:625; Interrogation_Position=488; Antisense; TGCCCAGGTATATTCCACTCGATTT
>probe:Drosophila_2:1623371_at:266:161; Interrogation_Position=518; Antisense; ACAAGTACCGCGTGGTCGTCATGGA
>probe:Drosophila_2:1623371_at:203:155; Interrogation_Position=55; Antisense; ACAGTGGGCCAGAGTCGCGTGAATC

Paste this into a BLAST search page for me
GCAATCTGGGTAACTTCTTCACCGAGATGCTATGCTTCATGCGTTTGTCAGGTGCCTTGGCAACTCGAGATGAAACAAGGATGCTTCATCGTCGTCTGAAGGAGTAACGTGACCATTGCCTTGACGAACTTTTCGAGTGCCTATTCCAGCAAGCAATTGTTTGCCATGTGCCCATTGACCCTCAGTCTGCGTGGTAAGCAAGATGAAACCCATTGCCGAGCGGACGTTACGATTTGAACGCCGATCAGCGGTAAGATGCTCCAAGTGCCTGGTGCTGCCCAGGTATATTCCACTCGATTTACAAGTACCGCGTGGTCGTCATGGAACAGTGGGCCAGAGTCGCGTGAATC

Full Affymetrix probeset data:

Annotations for 1623371_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720