FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623372_at:

>probe:Drosophila_2:1623372_at:674:371; Interrogation_Position=2484; Antisense; GAAGCTATCCCGATTGATCTGCGAC
>probe:Drosophila_2:1623372_at:272:39; Interrogation_Position=2500; Antisense; ATCTGCGACAACACCGACTTGATTG
>probe:Drosophila_2:1623372_at:414:27; Interrogation_Position=2525; Antisense; ATACTGTGCAAATCTACCCCATGGT
>probe:Drosophila_2:1623372_at:402:65; Interrogation_Position=2545; Antisense; ATGGTCTTGCCGGATCATGAAATCA
>probe:Drosophila_2:1623372_at:708:293; Interrogation_Position=2575; Antisense; CGAGTGCCCTGTAAGAGCGGTATTA
>probe:Drosophila_2:1623372_at:156:149; Interrogation_Position=2630; Antisense; ACTTTGGCGGTCATGGCGTAGATCC
>probe:Drosophila_2:1623372_at:597:677; Interrogation_Position=2648; Antisense; TAGATCCCTCTCTCTATAACTACAT
>probe:Drosophila_2:1623372_at:10:387; Interrogation_Position=2677; Antisense; GAAATACCCGACACGTTGCTGAACT
>probe:Drosophila_2:1623372_at:291:167; Interrogation_Position=2711; Antisense; AAATGCCATTTGTTTTTCTCACGAT
>probe:Drosophila_2:1623372_at:258:693; Interrogation_Position=2758; Antisense; TTTGTTTGACTCCATATCCTGTACC
>probe:Drosophila_2:1623372_at:100:489; Interrogation_Position=2778; Antisense; GTACCGTCTGTCTTCTATAGTTCAA
>probe:Drosophila_2:1623372_at:364:239; Interrogation_Position=2803; Antisense; AATCTTTTCACTTCTTACTGCTTAG
>probe:Drosophila_2:1623372_at:334:55; Interrogation_Position=2881; Antisense; ATGACACTGCCATTTCTTCAGAGCT
>probe:Drosophila_2:1623372_at:37:263; Interrogation_Position=2911; Antisense; CAGCATTTCCGTGCATGAACCATAC

Paste this into a BLAST search page for me
GAAGCTATCCCGATTGATCTGCGACATCTGCGACAACACCGACTTGATTGATACTGTGCAAATCTACCCCATGGTATGGTCTTGCCGGATCATGAAATCACGAGTGCCCTGTAAGAGCGGTATTAACTTTGGCGGTCATGGCGTAGATCCTAGATCCCTCTCTCTATAACTACATGAAATACCCGACACGTTGCTGAACTAAATGCCATTTGTTTTTCTCACGATTTTGTTTGACTCCATATCCTGTACCGTACCGTCTGTCTTCTATAGTTCAAAATCTTTTCACTTCTTACTGCTTAGATGACACTGCCATTTCTTCAGAGCTCAGCATTTCCGTGCATGAACCATAC

Full Affymetrix probeset data:

Annotations for 1623372_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720