FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623373_at:

>probe:Drosophila_2:1623373_at:415:401; Interrogation_Position=442; Antisense; GACTATATAGGACCGCCAGACGCGC
>probe:Drosophila_2:1623373_at:435:361; Interrogation_Position=465; Antisense; GCAATCAAACCTACGTCCGTACGTA
>probe:Drosophila_2:1623373_at:389:291; Interrogation_Position=482; Antisense; CGTACGTACGGCACTACGGCGATGA
>probe:Drosophila_2:1623373_at:267:379; Interrogation_Position=524; Antisense; GAAGCCTGCGTCTTAAGCGGATCGA
>probe:Drosophila_2:1623373_at:78:349; Interrogation_Position=556; Antisense; GCATGGAACACGGACTTCTGGACAA
>probe:Drosophila_2:1623373_at:206:185; Interrogation_Position=605; Antisense; AAAAGGAAGACTTCATCCGCCTGCA
>probe:Drosophila_2:1623373_at:207:331; Interrogation_Position=658; Antisense; GCGGACCAGATGAGCCACTTCTACA
>probe:Drosophila_2:1623373_at:137:713; Interrogation_Position=676; Antisense; TTCTACAAAGCGTTCCTCGACAAGA
>probe:Drosophila_2:1623373_at:676:107; Interrogation_Position=698; Antisense; AGAACTGGCGCATCCACATCATGTA
>probe:Drosophila_2:1623373_at:665:665; Interrogation_Position=721; Antisense; TACAACATCTCCTGGTACCTGAAGA
>probe:Drosophila_2:1623373_at:68:615; Interrogation_Position=740; Antisense; TGAAGAACTTCGACATACTCACCCT
>probe:Drosophila_2:1623373_at:198:705; Interrogation_Position=816; Antisense; TTAGGTGCAATATCTGTCGTCCCCA
>probe:Drosophila_2:1623373_at:332:599; Interrogation_Position=830; Antisense; TGTCGTCCCCATTTCGTAATTTCCA
>probe:Drosophila_2:1623373_at:579:489; Interrogation_Position=845; Antisense; GTAATTTCCAGTTTGCCGTTTGCAA

Paste this into a BLAST search page for me
GACTATATAGGACCGCCAGACGCGCGCAATCAAACCTACGTCCGTACGTACGTACGTACGGCACTACGGCGATGAGAAGCCTGCGTCTTAAGCGGATCGAGCATGGAACACGGACTTCTGGACAAAAAAGGAAGACTTCATCCGCCTGCAGCGGACCAGATGAGCCACTTCTACATTCTACAAAGCGTTCCTCGACAAGAAGAACTGGCGCATCCACATCATGTATACAACATCTCCTGGTACCTGAAGATGAAGAACTTCGACATACTCACCCTTTAGGTGCAATATCTGTCGTCCCCATGTCGTCCCCATTTCGTAATTTCCAGTAATTTCCAGTTTGCCGTTTGCAA

Full Affymetrix probeset data:

Annotations for 1623373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720