FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623375_at:

>probe:Drosophila_2:1623375_at:113:423; Interrogation_Position=2835; Antisense; GAGAATGCCCGAGATGACATCCGTG
>probe:Drosophila_2:1623375_at:131:271; Interrogation_Position=2852; Antisense; CATCCGTGTCCAGAAGGTGGATCTT
>probe:Drosophila_2:1623375_at:384:181; Interrogation_Position=2983; Antisense; AAAAACTGCGCGATGAGCTTCAGCA
>probe:Drosophila_2:1623375_at:490:419; Interrogation_Position=2997; Antisense; GAGCTTCAGCAGAGCTTGGCCATTA
>probe:Drosophila_2:1623375_at:575:71; Interrogation_Position=3025; Antisense; AGGTCACCAACGAAACCACTGATCT
>probe:Drosophila_2:1623375_at:463:175; Interrogation_Position=3037; Antisense; AAACCACTGATCTCATGCTCGGGCG
>probe:Drosophila_2:1623375_at:169:229; Interrogation_Position=3116; Antisense; AATGGACCGATTGCAACGTCAGCTC
>probe:Drosophila_2:1623375_at:97:497; Interrogation_Position=3133; Antisense; GTCAGCTCCAGCAAACATTGGATCA
>probe:Drosophila_2:1623375_at:306:73; Interrogation_Position=3183; Antisense; AGGCACCACGAGGAGTTGGCTGAAA
>probe:Drosophila_2:1623375_at:301:189; Interrogation_Position=3217; Antisense; AACAGGTACGCGATCTGCGTCGAAA
>probe:Drosophila_2:1623375_at:471:395; Interrogation_Position=3238; Antisense; GAAATCTCGCCGATGATCGCTACAA
>probe:Drosophila_2:1623375_at:80:45; Interrogation_Position=3253; Antisense; ATCGCTACAATCAGGCTAGGACACG
>probe:Drosophila_2:1623375_at:12:291; Interrogation_Position=3291; Antisense; CGGGTGCCATCGAAGACTCTTTAAT
>probe:Drosophila_2:1623375_at:301:27; Interrogation_Position=3323; Antisense; ATACTTATGCATACGCTTCTTGTTT

Paste this into a BLAST search page for me
GAGAATGCCCGAGATGACATCCGTGCATCCGTGTCCAGAAGGTGGATCTTAAAAACTGCGCGATGAGCTTCAGCAGAGCTTCAGCAGAGCTTGGCCATTAAGGTCACCAACGAAACCACTGATCTAAACCACTGATCTCATGCTCGGGCGAATGGACCGATTGCAACGTCAGCTCGTCAGCTCCAGCAAACATTGGATCAAGGCACCACGAGGAGTTGGCTGAAAAACAGGTACGCGATCTGCGTCGAAAGAAATCTCGCCGATGATCGCTACAAATCGCTACAATCAGGCTAGGACACGCGGGTGCCATCGAAGACTCTTTAATATACTTATGCATACGCTTCTTGTTT

Full Affymetrix probeset data:

Annotations for 1623375_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720