FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623377_at:

>probe:Drosophila_2:1623377_at:94:111; Interrogation_Position=376; Antisense; AGAAGGCGGTCCAAGCTGCTCGAGC
>probe:Drosophila_2:1623377_at:25:567; Interrogation_Position=420; Antisense; GGCAAGCAACAGATCATGGAGCAAC
>probe:Drosophila_2:1623377_at:724:77; Interrogation_Position=484; Antisense; AGGTTAAGAACTCACTCCACAGCAC
>probe:Drosophila_2:1623377_at:44:367; Interrogation_Position=522; Antisense; GAATCTGCCATGTTAGCGTTTTCCG
>probe:Drosophila_2:1623377_at:145:329; Interrogation_Position=537; Antisense; GCGTTTTCCGAAGCCAAGATTCAGC
>probe:Drosophila_2:1623377_at:590:611; Interrogation_Position=571; Antisense; TGAAAGTCCTTTTGGCTGAGGCCAC
>probe:Drosophila_2:1623377_at:368:69; Interrogation_Position=589; Antisense; AGGCCACCGCTCAAATGACCAACAT
>probe:Drosophila_2:1623377_at:312:389; Interrogation_Position=615; Antisense; GAAACTTTCGCTAATGGTGCCCAAT
>probe:Drosophila_2:1623377_at:701:419; Interrogation_Position=692; Antisense; GAGCATCTCCAGACAAGTGGTCGCT
>probe:Drosophila_2:1623377_at:125:337; Interrogation_Position=714; Antisense; GCTGCCAGGCAGGATTACGACAAGA
>probe:Drosophila_2:1623377_at:372:397; Interrogation_Position=732; Antisense; GACAAGACCAAGAAGGCTGCCTATA
>probe:Drosophila_2:1623377_at:502:71; Interrogation_Position=745; Antisense; AGGCTGCCTATAAGGCGGCTTGTGC
>probe:Drosophila_2:1623377_at:251:171; Interrogation_Position=805; Antisense; AAAGGGCGATTAGCTCTGCATCCTC
>probe:Drosophila_2:1623377_at:483:281; Interrogation_Position=818; Antisense; CTCTGCATCCTCTTCAAGCTAGAAA

Paste this into a BLAST search page for me
AGAAGGCGGTCCAAGCTGCTCGAGCGGCAAGCAACAGATCATGGAGCAACAGGTTAAGAACTCACTCCACAGCACGAATCTGCCATGTTAGCGTTTTCCGGCGTTTTCCGAAGCCAAGATTCAGCTGAAAGTCCTTTTGGCTGAGGCCACAGGCCACCGCTCAAATGACCAACATGAAACTTTCGCTAATGGTGCCCAATGAGCATCTCCAGACAAGTGGTCGCTGCTGCCAGGCAGGATTACGACAAGAGACAAGACCAAGAAGGCTGCCTATAAGGCTGCCTATAAGGCGGCTTGTGCAAAGGGCGATTAGCTCTGCATCCTCCTCTGCATCCTCTTCAAGCTAGAAA

Full Affymetrix probeset data:

Annotations for 1623377_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720