FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623378_at:

>probe:Drosophila_2:1623378_at:104:325; Interrogation_Position=1135; Antisense; GCTGAACATAAATGCCCGGGAACGA
>probe:Drosophila_2:1623378_at:45:199; Interrogation_Position=1155; Antisense; AACGACGAAGGATGCACGATTTGAA
>probe:Drosophila_2:1623378_at:322:369; Interrogation_Position=1177; Antisense; GAATGATGCCCTTGATGAGCTGAGA
>probe:Drosophila_2:1623378_at:243:423; Interrogation_Position=1198; Antisense; GAGAAGTGTGATTCCCTATGCCCAT
>probe:Drosophila_2:1623378_at:444:299; Interrogation_Position=1224; Antisense; CGCCTTCTGTGCGAAAGCTGTCGAA
>probe:Drosophila_2:1623378_at:508:501; Interrogation_Position=1243; Antisense; GTCGAAAATAGCCACCTTGCTGCTG
>probe:Drosophila_2:1623378_at:187:723; Interrogation_Position=1259; Antisense; TTGCTGCTGGCTAAGAACTACATTC
>probe:Drosophila_2:1623378_at:78:31; Interrogation_Position=1331; Antisense; ATACAAAGCACCACGGGAGCAGCGC
>probe:Drosophila_2:1623378_at:207:113; Interrogation_Position=1348; Antisense; AGCAGCGCCACTGGATTTGGGTGCA
>probe:Drosophila_2:1623378_at:133:21; Interrogation_Position=1362; Antisense; ATTTGGGTGCATTTCCGGCGGCTGC
>probe:Drosophila_2:1623378_at:437:215; Interrogation_Position=1388; Antisense; AAGTTGCAGGCTCTTCTTCAAGGAC
>probe:Drosophila_2:1623378_at:387:379; Interrogation_Position=1421; Antisense; GAACCACCGACTAGCAGCAGTTAAA
>probe:Drosophila_2:1623378_at:255:241; Interrogation_Position=1536; Antisense; AATACTTGTGTACTAGTCAGACGAA
>probe:Drosophila_2:1623378_at:405:75; Interrogation_Position=1573; Antisense; AGGAGCCTCTTATCAGAGCAGCCAA

Paste this into a BLAST search page for me
GCTGAACATAAATGCCCGGGAACGAAACGACGAAGGATGCACGATTTGAAGAATGATGCCCTTGATGAGCTGAGAGAGAAGTGTGATTCCCTATGCCCATCGCCTTCTGTGCGAAAGCTGTCGAAGTCGAAAATAGCCACCTTGCTGCTGTTGCTGCTGGCTAAGAACTACATTCATACAAAGCACCACGGGAGCAGCGCAGCAGCGCCACTGGATTTGGGTGCAATTTGGGTGCATTTCCGGCGGCTGCAAGTTGCAGGCTCTTCTTCAAGGACGAACCACCGACTAGCAGCAGTTAAAAATACTTGTGTACTAGTCAGACGAAAGGAGCCTCTTATCAGAGCAGCCAA

Full Affymetrix probeset data:

Annotations for 1623378_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720