Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623379_at:

>probe:Drosophila_2:1623379_at:101:591; Interrogation_Position=1956; Antisense; TGGTCCAAGGTGACAACTCCAGCGG
>probe:Drosophila_2:1623379_at:525:119; Interrogation_Position=1976; Antisense; AGCGGCATTTCGGACGACTTCGAGC
>probe:Drosophila_2:1623379_at:606:549; Interrogation_Position=2005; Antisense; GGAGTTCATACTCACCGACAACGAG
>probe:Drosophila_2:1623379_at:288:195; Interrogation_Position=2103; Antisense; AACTGCAGACACTGCGCTCCGAGAT
>probe:Drosophila_2:1623379_at:182:97; Interrogation_Position=2124; Antisense; AGATCGCGCCGCACAAGATTGAGGA
>probe:Drosophila_2:1623379_at:667:101; Interrogation_Position=2154; Antisense; AGAGCAACCTGGACATCCTCAGCGA
>probe:Drosophila_2:1623379_at:647:651; Interrogation_Position=2217; Antisense; TCAAGAAACTCAAGTCCGGCTCGAC
>probe:Drosophila_2:1623379_at:203:599; Interrogation_Position=2251; Antisense; TGTCGCCTTCTTCGAGGAGCTCTGA
>probe:Drosophila_2:1623379_at:686:611; Interrogation_Position=2336; Antisense; TGACTAATACCCCATCTAGCTGTAC
>probe:Drosophila_2:1623379_at:296:669; Interrogation_Position=2363; Antisense; TACGTTACGATTTGGCGTGTGTGCC
>probe:Drosophila_2:1623379_at:287:625; Interrogation_Position=2384; Antisense; TGCCTGTGCGCGTGCTAGAGTGTAT
>probe:Drosophila_2:1623379_at:326:485; Interrogation_Position=2405; Antisense; GTATGAGTGCCTTAACCGTAGTTGT
>probe:Drosophila_2:1623379_at:723:229; Interrogation_Position=2459; Antisense; AATGTTTTTCGATTGTTCGCTCAAG
>probe:Drosophila_2:1623379_at:441:635; Interrogation_Position=2475; Antisense; TCGCTCAAGCCGCTGCTGTAATAAA

Paste this into a BLAST search page for me
TGGTCCAAGGTGACAACTCCAGCGGAGCGGCATTTCGGACGACTTCGAGCGGAGTTCATACTCACCGACAACGAGAACTGCAGACACTGCGCTCCGAGATAGATCGCGCCGCACAAGATTGAGGAAGAGCAACCTGGACATCCTCAGCGATCAAGAAACTCAAGTCCGGCTCGACTGTCGCCTTCTTCGAGGAGCTCTGATGACTAATACCCCATCTAGCTGTACTACGTTACGATTTGGCGTGTGTGCCTGCCTGTGCGCGTGCTAGAGTGTATGTATGAGTGCCTTAACCGTAGTTGTAATGTTTTTCGATTGTTCGCTCAAGTCGCTCAAGCCGCTGCTGTAATAAA

Full Affymetrix probeset data:

Annotations for 1623379_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime