FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623384_at:

>probe:Drosophila_2:1623384_at:434:361; Interrogation_Position=1519; Antisense; GCAATCGAAAAGACCTCCCAACAAA
>probe:Drosophila_2:1623384_at:560:149; Interrogation_Position=1543; Antisense; ACTTCCTCCATACGCTGCAATAGTA
>probe:Drosophila_2:1623384_at:472:615; Interrogation_Position=1668; Antisense; TGAATCCAACAATAGCCATAGCAAT
>probe:Drosophila_2:1623384_at:665:9; Interrogation_Position=1749; Antisense; ATTCCGATTTCAATCACAAGTGCCA
>probe:Drosophila_2:1623384_at:543:237; Interrogation_Position=1840; Antisense; AATCATTCTTTTGTACTCTTTTTAT
>probe:Drosophila_2:1623384_at:419:569; Interrogation_Position=1874; Antisense; GGCATGAATTTTTGTACGCCTCAAC
>probe:Drosophila_2:1623384_at:197:487; Interrogation_Position=1887; Antisense; GTACGCCTCAACGAGCTAACTATTT
>probe:Drosophila_2:1623384_at:88:713; Interrogation_Position=1923; Antisense; TTCAGTTACCCATTTCTTTGCGTTT
>probe:Drosophila_2:1623384_at:352:277; Interrogation_Position=1938; Antisense; CTTTGCGTTTGGAAAACAGCCACAT
>probe:Drosophila_2:1623384_at:153:161; Interrogation_Position=1971; Antisense; AAATTTGAACCATTTTGGACCAGCA
>probe:Drosophila_2:1623384_at:686:127; Interrogation_Position=1995; Antisense; ACCACTCACACACATCTTATAACAA
>probe:Drosophila_2:1623384_at:681:475; Interrogation_Position=2029; Antisense; GTTTTACACACACGAAATTGCAGGG
>probe:Drosophila_2:1623384_at:404:7; Interrogation_Position=2045; Antisense; ATTGCAGGGATTTTGTCTTATTTCA
>probe:Drosophila_2:1623384_at:550:497; Interrogation_Position=2059; Antisense; GTCTTATTTCATATTCTCCTACAAT

Paste this into a BLAST search page for me
GCAATCGAAAAGACCTCCCAACAAAACTTCCTCCATACGCTGCAATAGTATGAATCCAACAATAGCCATAGCAATATTCCGATTTCAATCACAAGTGCCAAATCATTCTTTTGTACTCTTTTTATGGCATGAATTTTTGTACGCCTCAACGTACGCCTCAACGAGCTAACTATTTTTCAGTTACCCATTTCTTTGCGTTTCTTTGCGTTTGGAAAACAGCCACATAAATTTGAACCATTTTGGACCAGCAACCACTCACACACATCTTATAACAAGTTTTACACACACGAAATTGCAGGGATTGCAGGGATTTTGTCTTATTTCAGTCTTATTTCATATTCTCCTACAAT

Full Affymetrix probeset data:

Annotations for 1623384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720