FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623387_at:

>probe:Drosophila_2:1623387_at:379:319; Interrogation_Position=1035; Antisense; GCCGAGAGTCTCTTTGACAATGCAA
>probe:Drosophila_2:1623387_at:364:53; Interrogation_Position=1054; Antisense; ATGCAATGCTGGGAGCTGGCCAATT
>probe:Drosophila_2:1623387_at:523:579; Interrogation_Position=1070; Antisense; TGGCCAATTGGCGTCCACCAGTGTG
>probe:Drosophila_2:1623387_at:134:607; Interrogation_Position=1103; Antisense; TGATGCGGATGTGCGGCTGTCACTT
>probe:Drosophila_2:1623387_at:229:651; Interrogation_Position=1122; Antisense; TCACTTTTCGGCTCAGTTGTCGTTA
>probe:Drosophila_2:1623387_at:489:669; Interrogation_Position=1145; Antisense; TACTGGTGGCAATACCCTTCTGCAA
>probe:Drosophila_2:1623387_at:597:101; Interrogation_Position=1168; Antisense; AAGGCTTTCCGGAGCGCCTAAATCG
>probe:Drosophila_2:1623387_at:21:665; Interrogation_Position=1186; Antisense; TAAATCGCGATCTCCAGCTGCGTGC
>probe:Drosophila_2:1623387_at:191:589; Interrogation_Position=1275; Antisense; TGGATTGGCGGCTCTATTCTAGCCA
>probe:Drosophila_2:1623387_at:490:275; Interrogation_Position=1293; Antisense; CTAGCCAGCATAGGTACTTTCCAAC
>probe:Drosophila_2:1623387_at:303:335; Interrogation_Position=920; Antisense; GCTGCAGGTCCTAGAAAATCCGTTC
>probe:Drosophila_2:1623387_at:331:637; Interrogation_Position=943; Antisense; TCGACGAACGGGTTGCTGCTCAAAT
>probe:Drosophila_2:1623387_at:648:235; Interrogation_Position=965; Antisense; AATCCCGACGGTACACTATGAGTTT
>probe:Drosophila_2:1623387_at:156:591; Interrogation_Position=995; Antisense; TGGTTATCATCAGGACTTTGGCTCT

Paste this into a BLAST search page for me
GCCGAGAGTCTCTTTGACAATGCAAATGCAATGCTGGGAGCTGGCCAATTTGGCCAATTGGCGTCCACCAGTGTGTGATGCGGATGTGCGGCTGTCACTTTCACTTTTCGGCTCAGTTGTCGTTATACTGGTGGCAATACCCTTCTGCAAAAGGCTTTCCGGAGCGCCTAAATCGTAAATCGCGATCTCCAGCTGCGTGCTGGATTGGCGGCTCTATTCTAGCCACTAGCCAGCATAGGTACTTTCCAACGCTGCAGGTCCTAGAAAATCCGTTCTCGACGAACGGGTTGCTGCTCAAATAATCCCGACGGTACACTATGAGTTTTGGTTATCATCAGGACTTTGGCTCT

Full Affymetrix probeset data:

Annotations for 1623387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720