FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623388_at:

>probe:Drosophila_2:1623388_at:72:181; Interrogation_Position=1006; Antisense; AAAAACAGCTTTAATCGCCTCATAA
>probe:Drosophila_2:1623388_at:581:451; Interrogation_Position=494; Antisense; GATCTCTGTGTGTGCCGTGAGGACA
>probe:Drosophila_2:1623388_at:45:439; Interrogation_Position=512; Antisense; GAGGACAGGCACTACTACTTTGATC
>probe:Drosophila_2:1623388_at:575:729; Interrogation_Position=588; Antisense; TTGGGCGCTGCACACATGGCAACTG
>probe:Drosophila_2:1623388_at:465:657; Interrogation_Position=654; Antisense; TAAGGGACAGCCTGCTTCATGGACA
>probe:Drosophila_2:1623388_at:344:111; Interrogation_Position=678; Antisense; AGCAATGCATGCCAATCTGTGATCA
>probe:Drosophila_2:1623388_at:128:41; Interrogation_Position=692; Antisense; ATCTGTGATCACAACTGCGGACCAC
>probe:Drosophila_2:1623388_at:448:623; Interrogation_Position=707; Antisense; TGCGGACCACGAGCTTACTGCTTCG
>probe:Drosophila_2:1623388_at:698:669; Interrogation_Position=722; Antisense; TACTGCTTCGCTCCTAACTTGTGTG
>probe:Drosophila_2:1623388_at:279:627; Interrogation_Position=749; Antisense; TGCCGGCACAAACAGCACCATTATG
>probe:Drosophila_2:1623388_at:631:15; Interrogation_Position=768; Antisense; ATTATGCTCACAACGGCATCTGCTC
>probe:Drosophila_2:1623388_at:381:641; Interrogation_Position=786; Antisense; TCTGCTCCGGGAACTATTGACCTAG
>probe:Drosophila_2:1623388_at:310:573; Interrogation_Position=833; Antisense; GGCTGTTTTAGGTCCCGCTGATGTC
>probe:Drosophila_2:1623388_at:227:303; Interrogation_Position=846; Antisense; CCCGCTGATGTCGTATGGATTTTAA

Paste this into a BLAST search page for me
AAAAACAGCTTTAATCGCCTCATAAGATCTCTGTGTGTGCCGTGAGGACAGAGGACAGGCACTACTACTTTGATCTTGGGCGCTGCACACATGGCAACTGTAAGGGACAGCCTGCTTCATGGACAAGCAATGCATGCCAATCTGTGATCAATCTGTGATCACAACTGCGGACCACTGCGGACCACGAGCTTACTGCTTCGTACTGCTTCGCTCCTAACTTGTGTGTGCCGGCACAAACAGCACCATTATGATTATGCTCACAACGGCATCTGCTCTCTGCTCCGGGAACTATTGACCTAGGGCTGTTTTAGGTCCCGCTGATGTCCCCGCTGATGTCGTATGGATTTTAA

Full Affymetrix probeset data:

Annotations for 1623388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720