FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623389_at:

>probe:Drosophila_2:1623389_at:35:15; Interrogation_Position=266; Antisense; ATTACGCAGCAACGCCAGTTAGCAG
>probe:Drosophila_2:1623389_at:401:475; Interrogation_Position=283; Antisense; GTTAGCAGCAAACCCATGCCAGTGG
>probe:Drosophila_2:1623389_at:473:83; Interrogation_Position=325; Antisense; AGTAGTGGATCCCTTAGTTCTTCGA
>probe:Drosophila_2:1623389_at:260:707; Interrogation_Position=338; Antisense; TTAGTTCTTCGACTACGGCTGCGAC
>probe:Drosophila_2:1623389_at:483:523; Interrogation_Position=384; Antisense; GGGCGTAGGCAAACCGCATCATTAC
>probe:Drosophila_2:1623389_at:159:221; Interrogation_Position=464; Antisense; AAGTGCAGGAGTTTCCACGTCAGTC
>probe:Drosophila_2:1623389_at:244:421; Interrogation_Position=502; Antisense; GAGAAACTGGGCTCCGGCGTATTTG
>probe:Drosophila_2:1623389_at:282:305; Interrogation_Position=515; Antisense; CCGGCGTATTTGGTGAGCTGCATTT
>probe:Drosophila_2:1623389_at:344:185; Interrogation_Position=546; Antisense; AACAAATGTGCTGAACGCTACCCTC
>probe:Drosophila_2:1623389_at:683:521; Interrogation_Position=596; Antisense; GGGCCAATGACCATCTGCGTAAGGA
>probe:Drosophila_2:1623389_at:657:527; Interrogation_Position=695; Antisense; GGGACGAGCCCATCTGCATTGTTCA
>probe:Drosophila_2:1623389_at:15:345; Interrogation_Position=710; Antisense; GCATTGTTCAGGACTACTCGCACTG
>probe:Drosophila_2:1623389_at:387:595; Interrogation_Position=737; Antisense; TGGGCGACTTGAACCAGTTCCTGCA
>probe:Drosophila_2:1623389_at:617:103; Interrogation_Position=776; Antisense; AGACCAGCGGACTGATGGCCAAGAA

Paste this into a BLAST search page for me
ATTACGCAGCAACGCCAGTTAGCAGGTTAGCAGCAAACCCATGCCAGTGGAGTAGTGGATCCCTTAGTTCTTCGATTAGTTCTTCGACTACGGCTGCGACGGGCGTAGGCAAACCGCATCATTACAAGTGCAGGAGTTTCCACGTCAGTCGAGAAACTGGGCTCCGGCGTATTTGCCGGCGTATTTGGTGAGCTGCATTTAACAAATGTGCTGAACGCTACCCTCGGGCCAATGACCATCTGCGTAAGGAGGGACGAGCCCATCTGCATTGTTCAGCATTGTTCAGGACTACTCGCACTGTGGGCGACTTGAACCAGTTCCTGCAAGACCAGCGGACTGATGGCCAAGAA

Full Affymetrix probeset data:

Annotations for 1623389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720