FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623390_at:

>probe:Drosophila_2:1623390_at:489:603; Interrogation_Position=1013; Antisense; TGTTCGTCACTCTGCTGATGACTAC
>probe:Drosophila_2:1623390_at:209:607; Interrogation_Position=1028; Antisense; TGATGACTACAAGCGCCACAGCCAT
>probe:Drosophila_2:1623390_at:72:597; Interrogation_Position=1055; Antisense; TGTGCGCTGCCATCATGACTGATCA
>probe:Drosophila_2:1623390_at:150:57; Interrogation_Position=1069; Antisense; ATGACTGATCACTGGGAGCACGTTA
>probe:Drosophila_2:1623390_at:595:419; Interrogation_Position=1084; Antisense; GAGCACGTTACATGGGACCGCAACA
>probe:Drosophila_2:1623390_at:465:237; Interrogation_Position=1126; Antisense; AATCGATCGGGACTGCATCTGGAGT
>probe:Drosophila_2:1623390_at:252:41; Interrogation_Position=1142; Antisense; ATCTGGAGTGGCTTCTCGACGACCA
>probe:Drosophila_2:1623390_at:373:635; Interrogation_Position=1157; Antisense; TCGACGACCAGGTGGCTATGCTCAA
>probe:Drosophila_2:1623390_at:407:331; Interrogation_Position=1244; Antisense; GCGGCATCTGGACACTGTGCATTGA
>probe:Drosophila_2:1623390_at:394:597; Interrogation_Position=1259; Antisense; TGTGCATTGATCTGCCCATTCAGCA
>probe:Drosophila_2:1623390_at:51:597; Interrogation_Position=1323; Antisense; TGCTCCTCCGTGTGTAAACTACCTG
>probe:Drosophila_2:1623390_at:649:671; Interrogation_Position=1342; Antisense; TACCTGGCCGGCTCAATGGAAAACG
>probe:Drosophila_2:1623390_at:664:607; Interrogation_Position=1421; Antisense; TGCAGCCGCATCTGAGTACGTATTC
>probe:Drosophila_2:1623390_at:553:519; Interrogation_Position=1449; Antisense; GGCAGCCGGTTTGTTAATCCCAGTC

Paste this into a BLAST search page for me
TGTTCGTCACTCTGCTGATGACTACTGATGACTACAAGCGCCACAGCCATTGTGCGCTGCCATCATGACTGATCAATGACTGATCACTGGGAGCACGTTAGAGCACGTTACATGGGACCGCAACAAATCGATCGGGACTGCATCTGGAGTATCTGGAGTGGCTTCTCGACGACCATCGACGACCAGGTGGCTATGCTCAAGCGGCATCTGGACACTGTGCATTGATGTGCATTGATCTGCCCATTCAGCATGCTCCTCCGTGTGTAAACTACCTGTACCTGGCCGGCTCAATGGAAAACGTGCAGCCGCATCTGAGTACGTATTCGGCAGCCGGTTTGTTAATCCCAGTC

Full Affymetrix probeset data:

Annotations for 1623390_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720