FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623391_at:

>probe:Drosophila_2:1623391_at:112:39; Interrogation_Position=229; Antisense; ATCTCAAAATGCACTACGCCGACGA
>probe:Drosophila_2:1623391_at:135:201; Interrogation_Position=259; Antisense; AACGCTACGTAGACCAGATGCTCCT
>probe:Drosophila_2:1623391_at:217:447; Interrogation_Position=275; Antisense; GATGCTCCTGGAGAATCCCATTGTT
>probe:Drosophila_2:1623391_at:560:419; Interrogation_Position=333; Antisense; GAGCTTGCTATGGATTGCCGCGGAT
>probe:Drosophila_2:1623391_at:690:717; Interrogation_Position=374; Antisense; TTCCGGTTCTGGTTCGGATGTCAAG
>probe:Drosophila_2:1623391_at:441:443; Interrogation_Position=390; Antisense; GATGTCAAGGATGCCCAGCGTCAGA
>probe:Drosophila_2:1623391_at:522:265; Interrogation_Position=411; Antisense; CAGAGGGCCGAGTCGTGCCGCAAAT
>probe:Drosophila_2:1623391_at:235:567; Interrogation_Position=478; Antisense; GGCACAAATTCGTCAGCGGGCAGCT
>probe:Drosophila_2:1623391_at:478:213; Interrogation_Position=507; Antisense; AAGAGCGCCGTCATGTTGGACACGA
>probe:Drosophila_2:1623391_at:563:157; Interrogation_Position=591; Antisense; ACACTCGAGCGGATGCGGGCCACTT
>probe:Drosophila_2:1623391_at:163:309; Interrogation_Position=609; Antisense; GCCACTTTCGGCCTGGAAATGGAGC
>probe:Drosophila_2:1623391_at:159:277; Interrogation_Position=652; Antisense; CTATGTGTCGCAGGAACGGATCCCT
>probe:Drosophila_2:1623391_at:618:545; Interrogation_Position=669; Antisense; GGATCCCTGACTAGTCCAGCATTAG
>probe:Drosophila_2:1623391_at:462:309; Interrogation_Position=684; Antisense; CCAGCATTAGCCATACCACTTTTTT

Paste this into a BLAST search page for me
ATCTCAAAATGCACTACGCCGACGAAACGCTACGTAGACCAGATGCTCCTGATGCTCCTGGAGAATCCCATTGTTGAGCTTGCTATGGATTGCCGCGGATTTCCGGTTCTGGTTCGGATGTCAAGGATGTCAAGGATGCCCAGCGTCAGACAGAGGGCCGAGTCGTGCCGCAAATGGCACAAATTCGTCAGCGGGCAGCTAAGAGCGCCGTCATGTTGGACACGAACACTCGAGCGGATGCGGGCCACTTGCCACTTTCGGCCTGGAAATGGAGCCTATGTGTCGCAGGAACGGATCCCTGGATCCCTGACTAGTCCAGCATTAGCCAGCATTAGCCATACCACTTTTTT

Full Affymetrix probeset data:

Annotations for 1623391_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720