FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623392_at:

>probe:Drosophila_2:1623392_at:311:213; Interrogation_Position=111; Antisense; AAGAGCCGACAGTTTTCCATCACAG
>probe:Drosophila_2:1623392_at:384:651; Interrogation_Position=130; Antisense; TCACAGCGTCATCGTTGGAATACAA
>probe:Drosophila_2:1623392_at:451:395; Interrogation_Position=160; Antisense; GAAATCGCTGCGATTCTTATCAGCT
>probe:Drosophila_2:1623392_at:728:657; Interrogation_Position=189; Antisense; TAAGCATGGCGAGTGGCAGTCCAAA
>probe:Drosophila_2:1623392_at:715:95; Interrogation_Position=214; Antisense; GAGGTTCGGACCAGGCCCAAAAGCG
>probe:Drosophila_2:1623392_at:205:451; Interrogation_Position=239; Antisense; GATCGCTCTTGCTCTACTCAAGGAA
>probe:Drosophila_2:1623392_at:403:155; Interrogation_Position=275; Antisense; ACAGACGCGATGGTTACTGCTGGAA
>probe:Drosophila_2:1623392_at:592:397; Interrogation_Position=318; Antisense; GACAACGCGCGAGGATCACATGAAA
>probe:Drosophila_2:1623392_at:559:567; Interrogation_Position=355; Antisense; GGCACTGAGTGCATCTATGGTTGTT
>probe:Drosophila_2:1623392_at:99:541; Interrogation_Position=373; Antisense; GGTTGTTATGTACACTCGGCCATAT
>probe:Drosophila_2:1623392_at:476:21; Interrogation_Position=394; Antisense; ATATTGCCCACATTTCATCGCAGAT
>probe:Drosophila_2:1623392_at:576:43; Interrogation_Position=410; Antisense; ATCGCAGATGTTACTGGCTGTTGCA
>probe:Drosophila_2:1623392_at:480:91; Interrogation_Position=56; Antisense; AGTTTCTCAGAAATGGCGAACCCAT
>probe:Drosophila_2:1623392_at:714:33; Interrogation_Position=79; Antisense; ATCAAGCTGCCCGACAATTTGGAGA

Paste this into a BLAST search page for me
AAGAGCCGACAGTTTTCCATCACAGTCACAGCGTCATCGTTGGAATACAAGAAATCGCTGCGATTCTTATCAGCTTAAGCATGGCGAGTGGCAGTCCAAAGAGGTTCGGACCAGGCCCAAAAGCGGATCGCTCTTGCTCTACTCAAGGAAACAGACGCGATGGTTACTGCTGGAAGACAACGCGCGAGGATCACATGAAAGGCACTGAGTGCATCTATGGTTGTTGGTTGTTATGTACACTCGGCCATATATATTGCCCACATTTCATCGCAGATATCGCAGATGTTACTGGCTGTTGCAAGTTTCTCAGAAATGGCGAACCCATATCAAGCTGCCCGACAATTTGGAGA

Full Affymetrix probeset data:

Annotations for 1623392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720