FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623394_at:

>probe:Drosophila_2:1623394_at:29:181; Interrogation_Position=3086; Antisense; AAACACATGGGTACAGTCCCCGCAG
>probe:Drosophila_2:1623394_at:326:353; Interrogation_Position=3107; Antisense; GCAGCTATGCCGATCGTTTGGCTCG
>probe:Drosophila_2:1623394_at:192:267; Interrogation_Position=3162; Antisense; CAGTGCCCATGGATCCGAGGAACGA
>probe:Drosophila_2:1623394_at:378:199; Interrogation_Position=3198; Antisense; AACGACTTCGCACCACTCAATAAGG
>probe:Drosophila_2:1623394_at:7:141; Interrogation_Position=3244; Antisense; ACGGGTCACATTTGCGACTCCAGTT
>probe:Drosophila_2:1623394_at:94:595; Interrogation_Position=3329; Antisense; TGGGCTCCCACGAAGTTCTCGAGGA
>probe:Drosophila_2:1623394_at:717:381; Interrogation_Position=3373; Antisense; GAACGCCTGCACACGGTGGAATCAG
>probe:Drosophila_2:1623394_at:301:521; Interrogation_Position=3388; Antisense; GTGGAATCAGAGAACCAGGCCCTAA
>probe:Drosophila_2:1623394_at:588:181; Interrogation_Position=3417; Antisense; AAAACTCTCGCAGCAGCAGTGGGAT
>probe:Drosophila_2:1623394_at:136:529; Interrogation_Position=3437; Antisense; GGGATCTGGAGAATCGACTAGCCGA
>probe:Drosophila_2:1623394_at:692:163; Interrogation_Position=3473; Antisense; AAATCTGCGGAGTTTCGTCGACGTC
>probe:Drosophila_2:1623394_at:324:505; Interrogation_Position=3495; Antisense; GTCCAGCGTCGATCCCGAGAATGAG
>probe:Drosophila_2:1623394_at:573:103; Interrogation_Position=3613; Antisense; AGACCAATCGAGAGCGCAACGGGAT
>probe:Drosophila_2:1623394_at:360:529; Interrogation_Position=3633; Antisense; GGGATCTCAGTCCTGTGCCAAGTAC

Paste this into a BLAST search page for me
AAACACATGGGTACAGTCCCCGCAGGCAGCTATGCCGATCGTTTGGCTCGCAGTGCCCATGGATCCGAGGAACGAAACGACTTCGCACCACTCAATAAGGACGGGTCACATTTGCGACTCCAGTTTGGGCTCCCACGAAGTTCTCGAGGAGAACGCCTGCACACGGTGGAATCAGGTGGAATCAGAGAACCAGGCCCTAAAAAACTCTCGCAGCAGCAGTGGGATGGGATCTGGAGAATCGACTAGCCGAAAATCTGCGGAGTTTCGTCGACGTCGTCCAGCGTCGATCCCGAGAATGAGAGACCAATCGAGAGCGCAACGGGATGGGATCTCAGTCCTGTGCCAAGTAC

Full Affymetrix probeset data:

Annotations for 1623394_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720