Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623396_at:

>probe:Drosophila_2:1623396_at:74:465; Interrogation_Position=1404; Antisense; GTTGGCTACTCAGGTGGCGGATATC
>probe:Drosophila_2:1623396_at:172:313; Interrogation_Position=1474; Antisense; GCCAAACTGGCTGTTCTTGAATGTT
>probe:Drosophila_2:1623396_at:726:109; Interrogation_Position=1539; Antisense; AGAAGGTGATGTTGCCACTGGCAGC
>probe:Drosophila_2:1623396_at:658:237; Interrogation_Position=1592; Antisense; AATCAGATGATCTCCAACACGCTGG
>probe:Drosophila_2:1623396_at:661:187; Interrogation_Position=1607; Antisense; AACACGCTGGGAACTGGCTGCACGT
>probe:Drosophila_2:1623396_at:220:573; Interrogation_Position=1622; Antisense; GGCTGCACGTTGTTAAGAGACTCTT
>probe:Drosophila_2:1623396_at:334:405; Interrogation_Position=1640; Antisense; GACTCTTTGCGGCAGATCATCTTAA
>probe:Drosophila_2:1623396_at:202:287; Interrogation_Position=1666; Antisense; CGGCGATTAACGCAACAGGCACTAA
>probe:Drosophila_2:1623396_at:108:661; Interrogation_Position=1703; Antisense; TAACGGATCGACTAATACCCAGCAA
>probe:Drosophila_2:1623396_at:552:471; Interrogation_Position=1746; Antisense; GTTCGAAGTTCTAAGATCCCCAGAT
>probe:Drosophila_2:1623396_at:137:49; Interrogation_Position=1769; Antisense; ATCCTTCTACCTCGAACAGCGTAAA
>probe:Drosophila_2:1623396_at:247:223; Interrogation_Position=1833; Antisense; AAGGGATATTCAACACCTCGGCACC
>probe:Drosophila_2:1623396_at:238:307; Interrogation_Position=1848; Antisense; CCTCGGCACCCTTGTTTAATGCAAA
>probe:Drosophila_2:1623396_at:104:381; Interrogation_Position=1918; Antisense; GAACATCCGTACCAAATTTGTGTCA

Paste this into a BLAST search page for me
GTTGGCTACTCAGGTGGCGGATATCGCCAAACTGGCTGTTCTTGAATGTTAGAAGGTGATGTTGCCACTGGCAGCAATCAGATGATCTCCAACACGCTGGAACACGCTGGGAACTGGCTGCACGTGGCTGCACGTTGTTAAGAGACTCTTGACTCTTTGCGGCAGATCATCTTAACGGCGATTAACGCAACAGGCACTAATAACGGATCGACTAATACCCAGCAAGTTCGAAGTTCTAAGATCCCCAGATATCCTTCTACCTCGAACAGCGTAAAAAGGGATATTCAACACCTCGGCACCCCTCGGCACCCTTGTTTAATGCAAAGAACATCCGTACCAAATTTGTGTCA

Full Affymetrix probeset data:

Annotations for 1623396_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime