Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623398_at:

>probe:Drosophila_2:1623398_at:431:75; Interrogation_Position=1308; Antisense; AGGACGACTACCTCTACATGACGGA
>probe:Drosophila_2:1623398_at:67:549; Interrogation_Position=1486; Antisense; GGAGGATAATGCCACTCTGACCGCA
>probe:Drosophila_2:1623398_at:530:513; Interrogation_Position=1517; Antisense; GTGATTGACCACGTGGCCAAGCGAC
>probe:Drosophila_2:1623398_at:172:401; Interrogation_Position=1547; Antisense; GACATCCAGAAGCAGCTGCGAGCTG
>probe:Drosophila_2:1623398_at:507:93; Interrogation_Position=1578; Antisense; AGTTCGCCGATGAGATTCCCCAGAA
>probe:Drosophila_2:1623398_at:661:161; Interrogation_Position=1605; Antisense; ACAATGGCAAGGTCGTCCGCCGATA
>probe:Drosophila_2:1623398_at:724:641; Interrogation_Position=1641; Antisense; TCTTCGTCGCCTTGTCCAAGAAGAA
>probe:Drosophila_2:1623398_at:260:613; Interrogation_Position=1667; Antisense; TGAAAACCGAGAACTGCCGTGCTTT
>probe:Drosophila_2:1623398_at:572:143; Interrogation_Position=1679; Antisense; ACTGCCGTGCTTTCGTTTGGAATAA
>probe:Drosophila_2:1623398_at:271:475; Interrogation_Position=1728; Antisense; GTTAGGCAATCCTGCTTTTCGATTT
>probe:Drosophila_2:1623398_at:135:459; Interrogation_Position=1748; Antisense; GATTTCTTTCGTCTGAATTTGCCCG
>probe:Drosophila_2:1623398_at:87:245; Interrogation_Position=1763; Antisense; AATTTGCCCGTCAAACACTTCTGAA
>probe:Drosophila_2:1623398_at:614:147; Interrogation_Position=1779; Antisense; ACTTCTGAAAAGTCGCCCACAACGT
>probe:Drosophila_2:1623398_at:255:321; Interrogation_Position=1793; Antisense; GCCCACAACGTTCAATTCTCAGAAT

Paste this into a BLAST search page for me
AGGACGACTACCTCTACATGACGGAGGAGGATAATGCCACTCTGACCGCAGTGATTGACCACGTGGCCAAGCGACGACATCCAGAAGCAGCTGCGAGCTGAGTTCGCCGATGAGATTCCCCAGAAACAATGGCAAGGTCGTCCGCCGATATCTTCGTCGCCTTGTCCAAGAAGAATGAAAACCGAGAACTGCCGTGCTTTACTGCCGTGCTTTCGTTTGGAATAAGTTAGGCAATCCTGCTTTTCGATTTGATTTCTTTCGTCTGAATTTGCCCGAATTTGCCCGTCAAACACTTCTGAAACTTCTGAAAAGTCGCCCACAACGTGCCCACAACGTTCAATTCTCAGAAT

Full Affymetrix probeset data:

Annotations for 1623398_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime