Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623402_at:

>probe:Drosophila_2:1623402_at:258:529; Interrogation_Position=1425; Antisense; GGGAGAACTTTCAAGCGCATCGATT
>probe:Drosophila_2:1623402_at:57:459; Interrogation_Position=1514; Antisense; GATATCCGAATGGTGAATCCAACAT
>probe:Drosophila_2:1623402_at:520:395; Interrogation_Position=1558; Antisense; GACAAACCCAAGTATTCCAAACAGA
>probe:Drosophila_2:1623402_at:511:595; Interrogation_Position=1654; Antisense; TGTGTGTGTTTGTGTCGAGTCATCG
>probe:Drosophila_2:1623402_at:273:637; Interrogation_Position=1668; Antisense; TCGAGTCATCGTCAAATCCGTGTCT
>probe:Drosophila_2:1623402_at:654:515; Interrogation_Position=1687; Antisense; GTGTCTCCGCCAATTTGTTACAGTC
>probe:Drosophila_2:1623402_at:497:601; Interrogation_Position=1702; Antisense; TGTTACAGTCATAGGCCGAGTCAGC
>probe:Drosophila_2:1623402_at:457:263; Interrogation_Position=1731; Antisense; CAGCTGAGCCGCATTTTAAACAAAT
>probe:Drosophila_2:1623402_at:494:181; Interrogation_Position=1786; Antisense; AAAACTACCATGTCAAAGCGAGCAA
>probe:Drosophila_2:1623402_at:651:155; Interrogation_Position=1800; Antisense; AAAGCGAGCAACACGACTAAGGGAT
>probe:Drosophila_2:1623402_at:102:223; Interrogation_Position=1818; Antisense; AAGGGATGCCACCAACTTGTTATAT
>probe:Drosophila_2:1623402_at:517:359; Interrogation_Position=1847; Antisense; GCAATGGAGGATTCATCCCCGCAAT
>probe:Drosophila_2:1623402_at:179:633; Interrogation_Position=1862; Antisense; TCCCCGCAATTAGCCTGTATGTGTA
>probe:Drosophila_2:1623402_at:178:257; Interrogation_Position=1921; Antisense; CAAACCTTTGATACAGCAATCGGAA

Paste this into a BLAST search page for me
GGGAGAACTTTCAAGCGCATCGATTGATATCCGAATGGTGAATCCAACATGACAAACCCAAGTATTCCAAACAGATGTGTGTGTTTGTGTCGAGTCATCGTCGAGTCATCGTCAAATCCGTGTCTGTGTCTCCGCCAATTTGTTACAGTCTGTTACAGTCATAGGCCGAGTCAGCCAGCTGAGCCGCATTTTAAACAAATAAAACTACCATGTCAAAGCGAGCAAAAAGCGAGCAACACGACTAAGGGATAAGGGATGCCACCAACTTGTTATATGCAATGGAGGATTCATCCCCGCAATTCCCCGCAATTAGCCTGTATGTGTACAAACCTTTGATACAGCAATCGGAA

Full Affymetrix probeset data:

Annotations for 1623402_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime