FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623404_at:

>probe:Drosophila_2:1623404_at:397:381; Interrogation_Position=561; Antisense; GAACGGCGCGCTGAAAAGAAACGTA
>probe:Drosophila_2:1623404_at:509:387; Interrogation_Position=578; Antisense; GAAACGTAAGCGTCGAAAACTCGAT
>probe:Drosophila_2:1623404_at:642:499; Interrogation_Position=589; Antisense; GTCGAAAACTCGATGTTGGTCACGA
>probe:Drosophila_2:1623404_at:322:603; Interrogation_Position=602; Antisense; TGTTGGTCACGAAAGTTCTGGCGAA
>probe:Drosophila_2:1623404_at:342:549; Interrogation_Position=632; Antisense; GGAGGAGCCTGTCGAACCAGCATCC
>probe:Drosophila_2:1623404_at:329:597; Interrogation_Position=641; Antisense; TGTCGAACCAGCATCCGAATCCCAT
>probe:Drosophila_2:1623404_at:9:47; Interrogation_Position=659; Antisense; ATCCCATCCAGAAGCCAGCAAGGAG
>probe:Drosophila_2:1623404_at:411:225; Interrogation_Position=678; Antisense; AAGGAGCCCACAGACTCAAAGGATG
>probe:Drosophila_2:1623404_at:621:169; Interrogation_Position=695; Antisense; AAAGGATGCCACCACGGCAGACGAA
>probe:Drosophila_2:1623404_at:386:385; Interrogation_Position=717; Antisense; GAACAGATCTGGCAACAACAACCCG
>probe:Drosophila_2:1623404_at:298:157; Interrogation_Position=731; Antisense; ACAACAACCCGATATAAGCCGAGAG
>probe:Drosophila_2:1623404_at:273:659; Interrogation_Position=745; Antisense; TAAGCCGAGAGCAAGCCTCCAGAGA
>probe:Drosophila_2:1623404_at:321:205; Interrogation_Position=757; Antisense; AAGCCTCCAGAGAGCAGGAATTCGA
>probe:Drosophila_2:1623404_at:320:637; Interrogation_Position=778; Antisense; TCGAGCGATATCTAGAGGATCTCAT

Paste this into a BLAST search page for me
GAACGGCGCGCTGAAAAGAAACGTAGAAACGTAAGCGTCGAAAACTCGATGTCGAAAACTCGATGTTGGTCACGATGTTGGTCACGAAAGTTCTGGCGAAGGAGGAGCCTGTCGAACCAGCATCCTGTCGAACCAGCATCCGAATCCCATATCCCATCCAGAAGCCAGCAAGGAGAAGGAGCCCACAGACTCAAAGGATGAAAGGATGCCACCACGGCAGACGAAGAACAGATCTGGCAACAACAACCCGACAACAACCCGATATAAGCCGAGAGTAAGCCGAGAGCAAGCCTCCAGAGAAAGCCTCCAGAGAGCAGGAATTCGATCGAGCGATATCTAGAGGATCTCAT

Full Affymetrix probeset data:

Annotations for 1623404_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720