Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623405_at:

>probe:Drosophila_2:1623405_at:481:513; Interrogation_Position=2627; Antisense; GTGTTCAACGATGTGGAGTGCCTCA
>probe:Drosophila_2:1623405_at:474:505; Interrogation_Position=2644; Antisense; GTGCCTCAAGCAGAAGTCACCGGTT
>probe:Drosophila_2:1623405_at:505:133; Interrogation_Position=2678; Antisense; ACGCGAAAGCGACCCAGCAATGGCA
>probe:Drosophila_2:1623405_at:530:227; Interrogation_Position=2696; Antisense; AATGGCAACATTTCGGCTCTGGGCG
>probe:Drosophila_2:1623405_at:26:617; Interrogation_Position=2771; Antisense; TGCAATCTCGGCATTGAGGGACACA
>probe:Drosophila_2:1623405_at:561:231; Interrogation_Position=2820; Antisense; AATGACTCAGCGTGGAATTCTCAAA
>probe:Drosophila_2:1623405_at:152:485; Interrogation_Position=2845; Antisense; GTCAATTACCCATTTAGTTCATAGT
>probe:Drosophila_2:1623405_at:533:655; Interrogation_Position=2894; Antisense; TAAGTTTATTACTCACCCACTTCGG
>probe:Drosophila_2:1623405_at:162:649; Interrogation_Position=2906; Antisense; TCACCCACTTCGGTTTTTGGAGTTG
>probe:Drosophila_2:1623405_at:548:633; Interrogation_Position=2984; Antisense; TCCCGTAAATGAATTCGCAACCCCT
>probe:Drosophila_2:1623405_at:150:361; Interrogation_Position=3000; Antisense; GCAACCCCTCGCAAATGGAAATGTT
>probe:Drosophila_2:1623405_at:452:595; Interrogation_Position=3021; Antisense; TGTTTCCTGCTCCAAATAGTCGGTA
>probe:Drosophila_2:1623405_at:218:489; Interrogation_Position=3044; Antisense; TACCCGGAGGGTATCTGCCAAGAGC
>probe:Drosophila_2:1623405_at:248:107; Interrogation_Position=3076; Antisense; AGAAACTATCCAAGCATCGTCCAAT

Paste this into a BLAST search page for me
GTGTTCAACGATGTGGAGTGCCTCAGTGCCTCAAGCAGAAGTCACCGGTTACGCGAAAGCGACCCAGCAATGGCAAATGGCAACATTTCGGCTCTGGGCGTGCAATCTCGGCATTGAGGGACACAAATGACTCAGCGTGGAATTCTCAAAGTCAATTACCCATTTAGTTCATAGTTAAGTTTATTACTCACCCACTTCGGTCACCCACTTCGGTTTTTGGAGTTGTCCCGTAAATGAATTCGCAACCCCTGCAACCCCTCGCAAATGGAAATGTTTGTTTCCTGCTCCAAATAGTCGGTATACCCGGAGGGTATCTGCCAAGAGCAGAAACTATCCAAGCATCGTCCAAT

Full Affymetrix probeset data:

Annotations for 1623405_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime