FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623407_at:

>probe:Drosophila_2:1623407_at:211:363; Interrogation_Position=201; Antisense; GAATTGACACCCACGCAAGTGCAGA
>probe:Drosophila_2:1623407_at:96:97; Interrogation_Position=251; Antisense; AGATCCGAATGCCTTTTACACGCTC
>probe:Drosophila_2:1623407_at:272:583; Interrogation_Position=327; Antisense; TGGCACCACTGGCTGGTGGTCAATA
>probe:Drosophila_2:1623407_at:352:203; Interrogation_Position=359; Antisense; GAACCAAGTCGAGAACGGCGTAGTT
>probe:Drosophila_2:1623407_at:463:23; Interrogation_Position=392; Antisense; ATATGTGGGTGCAGGTCCGCCGCAA
>probe:Drosophila_2:1623407_at:44:639; Interrogation_Position=431; Antisense; TCGTTACGTCTTCCTGGTCTTCAAA
>probe:Drosophila_2:1623407_at:450:591; Interrogation_Position=445; Antisense; TGGTCTTCAAACAGCCCCAAAAGCT
>probe:Drosophila_2:1623407_at:504:173; Interrogation_Position=464; Antisense; AAAGCTCACTTGCAACGAGCCCAAA
>probe:Drosophila_2:1623407_at:397:397; Interrogation_Position=507; Antisense; GACAAGCGAGCCAATTTCAGCACCT
>probe:Drosophila_2:1623407_at:91:19; Interrogation_Position=520; Antisense; ATTTCAGCACCTCCAAGTTCATGAG
>probe:Drosophila_2:1623407_at:539:543; Interrogation_Position=558; Antisense; GGAGATCCCATTGCCGGAAACTTTT
>probe:Drosophila_2:1623407_at:428:389; Interrogation_Position=574; Antisense; GAAACTTTTTTCAGGCACAGTGGGA
>probe:Drosophila_2:1623407_at:14:375; Interrogation_Position=638; Antisense; GAAGTAGTATCTTTCTCCTCATAAT
>probe:Drosophila_2:1623407_at:575:651; Interrogation_Position=659; Antisense; TAATTAGGCTCCCAAATCCCTACAA

Paste this into a BLAST search page for me
GAATTGACACCCACGCAAGTGCAGAAGATCCGAATGCCTTTTACACGCTCTGGCACCACTGGCTGGTGGTCAATAGAACCAAGTCGAGAACGGCGTAGTTATATGTGGGTGCAGGTCCGCCGCAATCGTTACGTCTTCCTGGTCTTCAAATGGTCTTCAAACAGCCCCAAAAGCTAAAGCTCACTTGCAACGAGCCCAAAGACAAGCGAGCCAATTTCAGCACCTATTTCAGCACCTCCAAGTTCATGAGGGAGATCCCATTGCCGGAAACTTTTGAAACTTTTTTCAGGCACAGTGGGAGAAGTAGTATCTTTCTCCTCATAATTAATTAGGCTCCCAAATCCCTACAA

Full Affymetrix probeset data:

Annotations for 1623407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720