Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623410_at:

>probe:Drosophila_2:1623410_at:331:699; Interrogation_Position=3725; Antisense; TTTACTCCTGATCAACTGGAGGAGC
>probe:Drosophila_2:1623410_at:4:709; Interrogation_Position=3726; Antisense; TTACTCCTGATCAACTGGAGGAGCT
>probe:Drosophila_2:1623410_at:149:407; Interrogation_Position=3826; Antisense; GACTGTTTCCCATTCATCAACTGGA
>probe:Drosophila_2:1623410_at:729:285; Interrogation_Position=3828; Antisense; CTGTTTCCCATTCATCAACTGGAGG
>probe:Drosophila_2:1623410_at:150:407; Interrogation_Position=3932; Antisense; GACTGTTTCCCATTCGAATCCGATT
>probe:Drosophila_2:1623410_at:98:143; Interrogation_Position=3933; Antisense; ACTGTTTCCCATTCGAATCCGATTA
>probe:Drosophila_2:1623410_at:494:285; Interrogation_Position=3934; Antisense; CTGTTTCCCATTCGAATCCGATTAT
>probe:Drosophila_2:1623410_at:720:479; Interrogation_Position=3936; Antisense; GTTTCCCATTCGAATCCGATTATAC
>probe:Drosophila_2:1623410_at:168:633; Interrogation_Position=3939; Antisense; TCCCATTCGAATCCGATTATACCGT
>probe:Drosophila_2:1623410_at:226:717; Interrogation_Position=3944; Antisense; TTCGAATCCGATTATACCGTGCTCA
>probe:Drosophila_2:1623410_at:449:297; Interrogation_Position=3946; Antisense; CGAATCCGATTATACCGTGCTCAAA
>probe:Drosophila_2:1623410_at:189:373; Interrogation_Position=4046; Antisense; GAAGTGAATCCGATTATACCGTGCT
>probe:Drosophila_2:1623410_at:672:85; Interrogation_Position=4048; Antisense; AGTGAATCCGATTATACCGTGCTCA
>probe:Drosophila_2:1623410_at:524:613; Interrogation_Position=4050; Antisense; TGAATCCGATTATACCGTGCTCAAA

Paste this into a BLAST search page for me
TTTACTCCTGATCAACTGGAGGAGCTTACTCCTGATCAACTGGAGGAGCTGACTGTTTCCCATTCATCAACTGGACTGTTTCCCATTCATCAACTGGAGGGACTGTTTCCCATTCGAATCCGATTACTGTTTCCCATTCGAATCCGATTACTGTTTCCCATTCGAATCCGATTATGTTTCCCATTCGAATCCGATTATACTCCCATTCGAATCCGATTATACCGTTTCGAATCCGATTATACCGTGCTCACGAATCCGATTATACCGTGCTCAAAGAAGTGAATCCGATTATACCGTGCTAGTGAATCCGATTATACCGTGCTCATGAATCCGATTATACCGTGCTCAAA

Full Affymetrix probeset data:

Annotations for 1623410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime