Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623411_at:

>probe:Drosophila_2:1623411_at:529:665; Interrogation_Position=2978; Antisense; TACAATCTGCGCACCCAGGAAAGTT
>probe:Drosophila_2:1623411_at:617:391; Interrogation_Position=2996; Antisense; GAAAGTTCCGGTTCTTCGGCAGATC
>probe:Drosophila_2:1623411_at:371:567; Interrogation_Position=3013; Antisense; GGCAGATCTGCCAAGTACTTCCAAG
>probe:Drosophila_2:1623411_at:703:435; Interrogation_Position=3104; Antisense; GAGGAACCCACGGACTTGGACAATG
>probe:Drosophila_2:1623411_at:505:545; Interrogation_Position=3160; Antisense; GGATGCCATGATAGCCCTGCAGCAA
>probe:Drosophila_2:1623411_at:2:619; Interrogation_Position=3213; Antisense; TGCAGCATCTCGTCCAGAACATGAG
>probe:Drosophila_2:1623411_at:268:687; Interrogation_Position=3241; Antisense; TATAGACAACAGTGCCCTGGTTCCT
>probe:Drosophila_2:1623411_at:51:207; Interrogation_Position=3272; Antisense; AAGCTTCCGCGGAACGCAGCGAAGA
>probe:Drosophila_2:1623411_at:407:243; Interrogation_Position=3306; Antisense; AATATGAGTCCAACCGATGTCCACT
>probe:Drosophila_2:1623411_at:219:35; Interrogation_Position=3349; Antisense; ATCCCAGGCCTTTCTTAACGAACAT
>probe:Drosophila_2:1623411_at:178:25; Interrogation_Position=3372; Antisense; ATATGCGCAAGGAGCACTCTGTGCT
>probe:Drosophila_2:1623411_at:484:397; Interrogation_Position=3403; Antisense; GACACACTTTCATTTTAACTTCGTT
>probe:Drosophila_2:1623411_at:555:559; Interrogation_Position=3442; Antisense; GGAAAATCCAACTCATGTCAGTCTA
>probe:Drosophila_2:1623411_at:625:495; Interrogation_Position=3458; Antisense; GTCAGTCTATTCTATACCATTCTAT

Paste this into a BLAST search page for me
TACAATCTGCGCACCCAGGAAAGTTGAAAGTTCCGGTTCTTCGGCAGATCGGCAGATCTGCCAAGTACTTCCAAGGAGGAACCCACGGACTTGGACAATGGGATGCCATGATAGCCCTGCAGCAATGCAGCATCTCGTCCAGAACATGAGTATAGACAACAGTGCCCTGGTTCCTAAGCTTCCGCGGAACGCAGCGAAGAAATATGAGTCCAACCGATGTCCACTATCCCAGGCCTTTCTTAACGAACATATATGCGCAAGGAGCACTCTGTGCTGACACACTTTCATTTTAACTTCGTTGGAAAATCCAACTCATGTCAGTCTAGTCAGTCTATTCTATACCATTCTAT

Full Affymetrix probeset data:

Annotations for 1623411_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime