FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623415_at:

>probe:Drosophila_2:1623415_at:135:1; Interrogation_Position=4190; Antisense; AAGTTGACTGTTGAGATTTTTCCCA
>probe:Drosophila_2:1623415_at:659:425; Interrogation_Position=4202; Antisense; GAGATTTTTCCCAAACTGGTGTCGG
>probe:Drosophila_2:1623415_at:99:179; Interrogation_Position=4214; Antisense; AAACTGGTGTCGGTCTTCTCTATCC
>probe:Drosophila_2:1623415_at:543:715; Interrogation_Position=4229; Antisense; TTCTCTATCCTCTATTGTGTCTGTC
>probe:Drosophila_2:1623415_at:186:597; Interrogation_Position=4244; Antisense; TGTGTCTGTCGCGACTTTGAGTCGA
>probe:Drosophila_2:1623415_at:518:607; Interrogation_Position=4261; Antisense; TGAGTCGATTTTTTCCCATGTGTTT
>probe:Drosophila_2:1623415_at:667:365; Interrogation_Position=4286; Antisense; GAATCCACTTGGGTACACATACTTT
>probe:Drosophila_2:1623415_at:95:401; Interrogation_Position=4329; Antisense; GACATCTAACTGAATCCTACCTAGT
>probe:Drosophila_2:1623415_at:385:721; Interrogation_Position=4373; Antisense; TTGATGTTTTCTTCGGTATACCAAA
>probe:Drosophila_2:1623415_at:415:105; Interrogation_Position=4397; Antisense; AGACTACTTAACAAATCATCGCCCC
>probe:Drosophila_2:1623415_at:507:301; Interrogation_Position=4419; Antisense; CCCCGATGACGTATTACTCGAATAG
>probe:Drosophila_2:1623415_at:14:147; Interrogation_Position=4490; Antisense; ACTCACCCAGAACACCATGAAATCT
>probe:Drosophila_2:1623415_at:210:531; Interrogation_Position=4525; Antisense; GGGTAATGTCCCCACTATATTTATA
>probe:Drosophila_2:1623415_at:124:725; Interrogation_Position=4622; Antisense; TTGTCGCTTTTCTACTCGTTTACAT

Paste this into a BLAST search page for me
AAGTTGACTGTTGAGATTTTTCCCAGAGATTTTTCCCAAACTGGTGTCGGAAACTGGTGTCGGTCTTCTCTATCCTTCTCTATCCTCTATTGTGTCTGTCTGTGTCTGTCGCGACTTTGAGTCGATGAGTCGATTTTTTCCCATGTGTTTGAATCCACTTGGGTACACATACTTTGACATCTAACTGAATCCTACCTAGTTTGATGTTTTCTTCGGTATACCAAAAGACTACTTAACAAATCATCGCCCCCCCCGATGACGTATTACTCGAATAGACTCACCCAGAACACCATGAAATCTGGGTAATGTCCCCACTATATTTATATTGTCGCTTTTCTACTCGTTTACAT

Full Affymetrix probeset data:

Annotations for 1623415_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720