FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623416_at:

>probe:Drosophila_2:1623416_at:387:159; Interrogation_Position=4822; Antisense; ACAACCTTAGAACCCTCATCAAGTT
>probe:Drosophila_2:1623416_at:489:191; Interrogation_Position=4863; Antisense; AACTTCAAGTCTACCACCATTGTCT
>probe:Drosophila_2:1623416_at:670:273; Interrogation_Position=4880; Antisense; CATTGTCTTGCAGTACCGGGTATCA
>probe:Drosophila_2:1623416_at:253:685; Interrogation_Position=4900; Antisense; TATCAATATTTACCCCATCCAACAA
>probe:Drosophila_2:1623416_at:150:351; Interrogation_Position=4946; Antisense; GCAGCAACGGGCATGAACTAATTAT
>probe:Drosophila_2:1623416_at:696:583; Interrogation_Position=4970; Antisense; TGGAGTGCCCAGCTAATCTTTATTG
>probe:Drosophila_2:1623416_at:105:463; Interrogation_Position=5023; Antisense; GATTCAGGTGTTTGCTACAACGACA
>probe:Drosophila_2:1623416_at:61:413; Interrogation_Position=5081; Antisense; GACCTGGAGTGGATTTCCTTGCACA
>probe:Drosophila_2:1623416_at:233:49; Interrogation_Position=5105; Antisense; ATCCAACGGACTGCACCATGTATTT
>probe:Drosophila_2:1623416_at:461:221; Interrogation_Position=5161; Antisense; AAGTGTCCAGATCCGCTGTATTGGA
>probe:Drosophila_2:1623416_at:390:7; Interrogation_Position=5222; Antisense; ATTGCACAAATCTTCGGGCGAGTCA
>probe:Drosophila_2:1623416_at:291:431; Interrogation_Position=5241; Antisense; GAGTCAATCGATTTCTTGCGCAGCG
>probe:Drosophila_2:1623416_at:240:281; Interrogation_Position=5361; Antisense; CTGGAATCCCGTTAGTCAAGTTTGC
>probe:Drosophila_2:1623416_at:294:183; Interrogation_Position=5387; Antisense; AAAAGTCCCGGCGATTCTGCACATA

Paste this into a BLAST search page for me
ACAACCTTAGAACCCTCATCAAGTTAACTTCAAGTCTACCACCATTGTCTCATTGTCTTGCAGTACCGGGTATCATATCAATATTTACCCCATCCAACAAGCAGCAACGGGCATGAACTAATTATTGGAGTGCCCAGCTAATCTTTATTGGATTCAGGTGTTTGCTACAACGACAGACCTGGAGTGGATTTCCTTGCACAATCCAACGGACTGCACCATGTATTTAAGTGTCCAGATCCGCTGTATTGGAATTGCACAAATCTTCGGGCGAGTCAGAGTCAATCGATTTCTTGCGCAGCGCTGGAATCCCGTTAGTCAAGTTTGCAAAAGTCCCGGCGATTCTGCACATA

Full Affymetrix probeset data:

Annotations for 1623416_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720