FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623418_at:

>probe:Drosophila_2:1623418_at:342:501; Interrogation_Position=2354; Antisense; GTCGTCGGGAGCTGTACAACATAAT
>probe:Drosophila_2:1623418_at:300:31; Interrogation_Position=2374; Antisense; ATAATGTACTACTGCTGGTCCCACG
>probe:Drosophila_2:1623418_at:320:417; Interrogation_Position=2407; Antisense; GAGCGTCCTCTATTCGCGGAAATAA
>probe:Drosophila_2:1623418_at:175:49; Interrogation_Position=2431; Antisense; ATCCAAATGCTCGACAAGCTGCTGC
>probe:Drosophila_2:1623418_at:319:1; Interrogation_Position=2471; Antisense; ATATCGAACTCGAGCGGTTTCCCGA
>probe:Drosophila_2:1623418_at:647:693; Interrogation_Position=2488; Antisense; TTTCCCGATCACAACTACTACAATA
>probe:Drosophila_2:1623418_at:691:413; Interrogation_Position=2578; Antisense; GAGCTTTATTACCTCCAAACGACTT
>probe:Drosophila_2:1623418_at:593:197; Interrogation_Position=2595; Antisense; AACGACTTTGGGACATCTGGTTCCA
>probe:Drosophila_2:1623418_at:719:419; Interrogation_Position=2655; Antisense; GAGAAGGTTTACACTGCCATTACGA
>probe:Drosophila_2:1623418_at:322:627; Interrogation_Position=2669; Antisense; TGCCATTACGAGTCGCACTGCAAAT
>probe:Drosophila_2:1623418_at:231:113; Interrogation_Position=2740; Antisense; AGCACTATCTTTGAGTTTCGGTTGA
>probe:Drosophila_2:1623418_at:131:459; Interrogation_Position=2767; Antisense; GATATACTCCAATGCAAAGGCCGTT
>probe:Drosophila_2:1623418_at:88:359; Interrogation_Position=2780; Antisense; GCAAAGGCCGTTGTAATTCCTCTTA
>probe:Drosophila_2:1623418_at:200:465; Interrogation_Position=2816; Antisense; GATTGCATTGTTTGCGTTCACGTTT

Paste this into a BLAST search page for me
GTCGTCGGGAGCTGTACAACATAATATAATGTACTACTGCTGGTCCCACGGAGCGTCCTCTATTCGCGGAAATAAATCCAAATGCTCGACAAGCTGCTGCATATCGAACTCGAGCGGTTTCCCGATTTCCCGATCACAACTACTACAATAGAGCTTTATTACCTCCAAACGACTTAACGACTTTGGGACATCTGGTTCCAGAGAAGGTTTACACTGCCATTACGATGCCATTACGAGTCGCACTGCAAATAGCACTATCTTTGAGTTTCGGTTGAGATATACTCCAATGCAAAGGCCGTTGCAAAGGCCGTTGTAATTCCTCTTAGATTGCATTGTTTGCGTTCACGTTT

Full Affymetrix probeset data:

Annotations for 1623418_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720