Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623419_s_at:

>probe:Drosophila_2:1623419_s_at:536:335; Interrogation_Position=154; Antisense; GCTCCGTTCAAGTCGCGAGTTAATC
>probe:Drosophila_2:1623419_s_at:380:427; Interrogation_Position=170; Antisense; GAGTTAATCTTATGTCCGCCTACGA
>probe:Drosophila_2:1623419_s_at:131:671; Interrogation_Position=190; Antisense; TACGATTGCCACAAGCTGCGCAAAG
>probe:Drosophila_2:1623419_s_at:364:79; Interrogation_Position=215; Antisense; AGGTTGCCCGCCAGGTGACGAATAG
>probe:Drosophila_2:1623419_s_at:702:409; Interrogation_Position=262; Antisense; GACGAAGGCAATCCGGTCACCTGGA
>probe:Drosophila_2:1623419_s_at:289:337; Interrogation_Position=288; Antisense; GCTCTGCCAACTGATCCTATTGATC
>probe:Drosophila_2:1623419_s_at:95:79; Interrogation_Position=315; Antisense; AGTGATGGTTTCCTCGATAATCGCC
>probe:Drosophila_2:1623419_s_at:321:33; Interrogation_Position=331; Antisense; ATAATCGCCATGGTGTGTGCCCTGA
>probe:Drosophila_2:1623419_s_at:696:515; Interrogation_Position=345; Antisense; GTGTGCCCTGAAAGTGATCTGCGAA
>probe:Drosophila_2:1623419_s_at:657:39; Interrogation_Position=361; Antisense; ATCTGCGAAAGCCAACGTCGCTGGT
>probe:Drosophila_2:1623419_s_at:613:589; Interrogation_Position=382; Antisense; TGGTCGGGCCGCACGAAATGTGCTC
>probe:Drosophila_2:1623419_s_at:36:171; Interrogation_Position=474; Antisense; AAAGGACTCCTGCAAGCCAGCCAAG
>probe:Drosophila_2:1623419_s_at:546:479; Interrogation_Position=548; Antisense; GTTTCGGTCCGTACAAGCACCAGAA
>probe:Drosophila_2:1623419_s_at:253:55; Interrogation_Position=64; Antisense; ATGAACGAGGTGTGTGCCCACTGCG

Paste this into a BLAST search page for me
GCTCCGTTCAAGTCGCGAGTTAATCGAGTTAATCTTATGTCCGCCTACGATACGATTGCCACAAGCTGCGCAAAGAGGTTGCCCGCCAGGTGACGAATAGGACGAAGGCAATCCGGTCACCTGGAGCTCTGCCAACTGATCCTATTGATCAGTGATGGTTTCCTCGATAATCGCCATAATCGCCATGGTGTGTGCCCTGAGTGTGCCCTGAAAGTGATCTGCGAAATCTGCGAAAGCCAACGTCGCTGGTTGGTCGGGCCGCACGAAATGTGCTCAAAGGACTCCTGCAAGCCAGCCAAGGTTTCGGTCCGTACAAGCACCAGAAATGAACGAGGTGTGTGCCCACTGCG

Full Affymetrix probeset data:

Annotations for 1623419_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime