FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623421_at:

>probe:Drosophila_2:1623421_at:94:383; Interrogation_Position=1004; Antisense; GAACTGAATCACTCGGTAACCGTGG
>probe:Drosophila_2:1623421_at:545:555; Interrogation_Position=1049; Antisense; GGACGCGACTACTGGATCATCAAGA
>probe:Drosophila_2:1623421_at:431:209; Interrogation_Position=1070; Antisense; AAGAACTCGTACTCTCAGAATTGGG
>probe:Drosophila_2:1623421_at:88:705; Interrogation_Position=1107; Antisense; TTATGCGCATCCTCCGGAATGCAGG
>probe:Drosophila_2:1623421_at:596:53; Interrogation_Position=1125; Antisense; ATGCAGGTGGATTCTGCGGCATCGC
>probe:Drosophila_2:1623421_at:717:485; Interrogation_Position=1251; Antisense; GTAGTCGTAAGCTGTGTGGGTCACC
>probe:Drosophila_2:1623421_at:270:43; Interrogation_Position=1278; Antisense; ATCGATTCCATGAGTCACGCGGTTA
>probe:Drosophila_2:1623421_at:206:695; Interrogation_Position=727; Antisense; TTTCGAGTACATACGCGATCACGGT
>probe:Drosophila_2:1623421_at:256:35; Interrogation_Position=744; Antisense; ATCACGGTGTAACGCTGGCCAACAA
>probe:Drosophila_2:1623421_at:551:445; Interrogation_Position=790; Antisense; GATGCAGTGCCGTCAGAACGAAACC
>probe:Drosophila_2:1623421_at:438:387; Interrogation_Position=844; Antisense; GAAAATTCGCGATTATGCCACCATT
>probe:Drosophila_2:1623421_at:300:527; Interrogation_Position=913; Antisense; GGGACCGTTGGCGTGCTCCATGAAC
>probe:Drosophila_2:1623421_at:510:331; Interrogation_Position=938; Antisense; GCGGACACCATTTCGTTTGAGCAGT
>probe:Drosophila_2:1623421_at:577:663; Interrogation_Position=962; Antisense; TACAGCGGTGGCATCTACGAGGACG

Paste this into a BLAST search page for me
GAACTGAATCACTCGGTAACCGTGGGGACGCGACTACTGGATCATCAAGAAAGAACTCGTACTCTCAGAATTGGGTTATGCGCATCCTCCGGAATGCAGGATGCAGGTGGATTCTGCGGCATCGCGTAGTCGTAAGCTGTGTGGGTCACCATCGATTCCATGAGTCACGCGGTTATTTCGAGTACATACGCGATCACGGTATCACGGTGTAACGCTGGCCAACAAGATGCAGTGCCGTCAGAACGAAACCGAAAATTCGCGATTATGCCACCATTGGGACCGTTGGCGTGCTCCATGAACGCGGACACCATTTCGTTTGAGCAGTTACAGCGGTGGCATCTACGAGGACG

Full Affymetrix probeset data:

Annotations for 1623421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720