FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623425_at:

>probe:Drosophila_2:1623425_at:620:487; Interrogation_Position=1125; Antisense; GTACACAGTTTTCACATTTTCACAC
>probe:Drosophila_2:1623425_at:302:571; Interrogation_Position=1212; Antisense; GGCTTGATCAGCTTTCTAGTATAAC
>probe:Drosophila_2:1623425_at:548:29; Interrogation_Position=678; Antisense; ATACTCCGGATGCTGTGAGCTTGCT
>probe:Drosophila_2:1623425_at:313:417; Interrogation_Position=722; Antisense; GAGCTCTTCCGGGTGGAGATTACGT
>probe:Drosophila_2:1623425_at:493:111; Interrogation_Position=749; Antisense; AGCAAGGTGATCTCTCTGTTCGCCA
>probe:Drosophila_2:1623425_at:98:595; Interrogation_Position=781; Antisense; TGGGCTGTCCGTTGATTGTGTACGC
>probe:Drosophila_2:1623425_at:238:5; Interrogation_Position=795; Antisense; ATTGTGTACGCCAAGGACATCCGGA
>probe:Drosophila_2:1623425_at:389:401; Interrogation_Position=810; Antisense; GACATCCGGAATACTTGCCCAAGTT
>probe:Drosophila_2:1623425_at:5:103; Interrogation_Position=840; Antisense; AGAGCGTTTCCGAGGTGATCGAAGA
>probe:Drosophila_2:1623425_at:375:215; Interrogation_Position=861; Antisense; AAGATGAGCTGGTTCCGTGGATTAA
>probe:Drosophila_2:1623425_at:455:549; Interrogation_Position=900; Antisense; GGAGTGGCATCAACACACACGTTTT
>probe:Drosophila_2:1623425_at:220:311; Interrogation_Position=933; Antisense; CCAACAGCCTGAATCCTTTAGAGTG
>probe:Drosophila_2:1623425_at:171:541; Interrogation_Position=957; Antisense; GGACCACTTTGGTTATAGGCGTAGT
>probe:Drosophila_2:1623425_at:179:575; Interrogation_Position=974; Antisense; GGCGTAGTTTTTGGCCTAATTCTAG

Paste this into a BLAST search page for me
GTACACAGTTTTCACATTTTCACACGGCTTGATCAGCTTTCTAGTATAACATACTCCGGATGCTGTGAGCTTGCTGAGCTCTTCCGGGTGGAGATTACGTAGCAAGGTGATCTCTCTGTTCGCCATGGGCTGTCCGTTGATTGTGTACGCATTGTGTACGCCAAGGACATCCGGAGACATCCGGAATACTTGCCCAAGTTAGAGCGTTTCCGAGGTGATCGAAGAAAGATGAGCTGGTTCCGTGGATTAAGGAGTGGCATCAACACACACGTTTTCCAACAGCCTGAATCCTTTAGAGTGGGACCACTTTGGTTATAGGCGTAGTGGCGTAGTTTTTGGCCTAATTCTAG

Full Affymetrix probeset data:

Annotations for 1623425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720