Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623426_at:

>probe:Drosophila_2:1623426_at:5:483; Interrogation_Position=1021; Antisense; GTATATGGGACGTGCTTCTTGCCTG
>probe:Drosophila_2:1623426_at:327:301; Interrogation_Position=1048; Antisense; CCCGTCTCAGGGAATTCAGCATGAT
>probe:Drosophila_2:1623426_at:68:455; Interrogation_Position=1070; Antisense; GATCAACCATGTTTTGTACGACGAG
>probe:Drosophila_2:1623426_at:27:673; Interrogation_Position=1086; Antisense; TACGACGAGTTCTTTGCCTTCAGCA
>probe:Drosophila_2:1623426_at:324:547; Interrogation_Position=1181; Antisense; GGATGACTTGGTTTCGAAGCACTTT
>probe:Drosophila_2:1623426_at:610:655; Interrogation_Position=1220; Antisense; TAATGTTTCCTTCAGTGCTACTAGT
>probe:Drosophila_2:1623426_at:216:177; Interrogation_Position=1290; Antisense; AAACGCCCCGAGTCGTGATTCACTA
>probe:Drosophila_2:1623426_at:36:499; Interrogation_Position=1376; Antisense; GTCTTTCGTCGATAAGCTGGTTATT
>probe:Drosophila_2:1623426_at:548:579; Interrogation_Position=877; Antisense; TGGCCAAACTGCGAAATCTCCGATG
>probe:Drosophila_2:1623426_at:338:39; Interrogation_Position=892; Antisense; ATCTCCGATGTTTAACTCTCGTCGA
>probe:Drosophila_2:1623426_at:235:371; Interrogation_Position=921; Antisense; GAAGGATGTGCTGCCATTGACTTTT
>probe:Drosophila_2:1623426_at:484:5; Interrogation_Position=936; Antisense; ATTGACTTTTCCACGATCACCTATT
>probe:Drosophila_2:1623426_at:304:691; Interrogation_Position=957; Antisense; TATTGCTTTCCGCTCTTGGAGCAAC
>probe:Drosophila_2:1623426_at:46:553; Interrogation_Position=989; Antisense; GGAGAACTCGCGTATATGGGTCAAC

Paste this into a BLAST search page for me
GTATATGGGACGTGCTTCTTGCCTGCCCGTCTCAGGGAATTCAGCATGATGATCAACCATGTTTTGTACGACGAGTACGACGAGTTCTTTGCCTTCAGCAGGATGACTTGGTTTCGAAGCACTTTTAATGTTTCCTTCAGTGCTACTAGTAAACGCCCCGAGTCGTGATTCACTAGTCTTTCGTCGATAAGCTGGTTATTTGGCCAAACTGCGAAATCTCCGATGATCTCCGATGTTTAACTCTCGTCGAGAAGGATGTGCTGCCATTGACTTTTATTGACTTTTCCACGATCACCTATTTATTGCTTTCCGCTCTTGGAGCAACGGAGAACTCGCGTATATGGGTCAAC

Full Affymetrix probeset data:

Annotations for 1623426_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime