Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623427_at:

>probe:Drosophila_2:1623427_at:382:475; Interrogation_Position=1638; Antisense; GTTACAGCCTCAGTTGGGCTTGCAA
>probe:Drosophila_2:1623427_at:668:167; Interrogation_Position=1712; Antisense; AAATGTGGCCGCTACAACCTGGTTA
>probe:Drosophila_2:1623427_at:660:253; Interrogation_Position=1726; Antisense; CAACCTGGTTATCCTGGCTATATCA
>probe:Drosophila_2:1623427_at:189:21; Interrogation_Position=1745; Antisense; ATATCAGTGGATATCCCCTACCCTT
>probe:Drosophila_2:1623427_at:330:585; Interrogation_Position=1847; Antisense; TGGAAACTAACTCCACTCGCAAGGA
>probe:Drosophila_2:1623427_at:473:545; Interrogation_Position=1869; Antisense; GGAGTTCTATTACTTCGACGGCGAC
>probe:Drosophila_2:1623427_at:609:721; Interrogation_Position=1901; Antisense; TTGCCCGTTCTGCTGTGGACGATGA
>probe:Drosophila_2:1623427_at:19:455; Interrogation_Position=1933; Antisense; GATAAGGCTCACCTGGGCGTCACAA
>probe:Drosophila_2:1623427_at:382:713; Interrogation_Position=1971; Antisense; TTCGTCCCAATCCATAGTTAAGCCA
>probe:Drosophila_2:1623427_at:698:429; Interrogation_Position=1996; Antisense; GAGTCACCTCTGGTTACGAAGGCCT
>probe:Drosophila_2:1623427_at:713:207; Interrogation_Position=2028; Antisense; AAGCAGTTGCTCCTTTGATTACATG
>probe:Drosophila_2:1623427_at:65:267; Interrogation_Position=2069; Antisense; CAGTCGACACTCTCTGGTTAACTAA
>probe:Drosophila_2:1623427_at:488:661; Interrogation_Position=2091; Antisense; TAAACCCTTGTGCTTTTCGCCGCTA
>probe:Drosophila_2:1623427_at:532:715; Interrogation_Position=2106; Antisense; TTCGCCGCTAAGAAGTTGGTTCCCA

Paste this into a BLAST search page for me
GTTACAGCCTCAGTTGGGCTTGCAAAAATGTGGCCGCTACAACCTGGTTACAACCTGGTTATCCTGGCTATATCAATATCAGTGGATATCCCCTACCCTTTGGAAACTAACTCCACTCGCAAGGAGGAGTTCTATTACTTCGACGGCGACTTGCCCGTTCTGCTGTGGACGATGAGATAAGGCTCACCTGGGCGTCACAATTCGTCCCAATCCATAGTTAAGCCAGAGTCACCTCTGGTTACGAAGGCCTAAGCAGTTGCTCCTTTGATTACATGCAGTCGACACTCTCTGGTTAACTAATAAACCCTTGTGCTTTTCGCCGCTATTCGCCGCTAAGAAGTTGGTTCCCA

Full Affymetrix probeset data:

Annotations for 1623427_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime