Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623428_at:

>probe:Drosophila_2:1623428_at:730:7; Interrogation_Position=384; Antisense; ATTCCACACATCCACACGTATAGAA
>probe:Drosophila_2:1623428_at:16:375; Interrogation_Position=414; Antisense; GAAGTATCTGACTTTGCTGCTCGTT
>probe:Drosophila_2:1623428_at:247:335; Interrogation_Position=429; Antisense; GCTGCTCGTTTTGGGCCTTTTGATC
>probe:Drosophila_2:1623428_at:690:633; Interrogation_Position=469; Antisense; TCGTCGGAGGGCAGCTATTGTCCTT
>probe:Drosophila_2:1623428_at:377:5; Interrogation_Position=485; Antisense; ATTGTCCTTGCGATCTGAAGACCAA
>probe:Drosophila_2:1623428_at:131:79; Interrogation_Position=518; Antisense; AGGTCTGCGGCTCAAATGGTGTCAC
>probe:Drosophila_2:1623428_at:615:533; Interrogation_Position=535; Antisense; GGTGTCACCTTCAAAAATCGCTGCG
>probe:Drosophila_2:1623428_at:234:427; Interrogation_Position=559; Antisense; GAGTTCGAGTGCAGCCAAAGGGATT
>probe:Drosophila_2:1623428_at:331:179; Interrogation_Position=589; Antisense; AAACTTGGACGGACCCTGAACATCA
>probe:Drosophila_2:1623428_at:104:225; Interrogation_Position=616; Antisense; AAGGATGGACCTTGCAACGAGACAA
>probe:Drosophila_2:1623428_at:461:19; Interrogation_Position=647; Antisense; ATATTATTCAACCTTCGATCCCAAC
>probe:Drosophila_2:1623428_at:208:233; Interrogation_Position=781; Antisense; AATGCTTTCTCTCGTTTATCTGTAA
>probe:Drosophila_2:1623428_at:180:365; Interrogation_Position=893; Antisense; GAATACGACTGCGAGCATCGGATAA
>probe:Drosophila_2:1623428_at:448:613; Interrogation_Position=940; Antisense; TGAAGTTCTTGGCTATGATGGCTCT

Paste this into a BLAST search page for me
ATTCCACACATCCACACGTATAGAAGAAGTATCTGACTTTGCTGCTCGTTGCTGCTCGTTTTGGGCCTTTTGATCTCGTCGGAGGGCAGCTATTGTCCTTATTGTCCTTGCGATCTGAAGACCAAAGGTCTGCGGCTCAAATGGTGTCACGGTGTCACCTTCAAAAATCGCTGCGGAGTTCGAGTGCAGCCAAAGGGATTAAACTTGGACGGACCCTGAACATCAAAGGATGGACCTTGCAACGAGACAAATATTATTCAACCTTCGATCCCAACAATGCTTTCTCTCGTTTATCTGTAAGAATACGACTGCGAGCATCGGATAATGAAGTTCTTGGCTATGATGGCTCT

Full Affymetrix probeset data:

Annotations for 1623428_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime